Scrigroup - Documente si articole

Username / Parola inexistente      

Home Documente Upload Resurse Alte limbi doc  

CATEGORII DOCUMENTE





AstronomieBiofizicaBiologieBotanicaCartiChimieCopii
Educatie civicaFabule ghicitoriFizicaGramaticaJocLiteratura romanaLogica
MatematicaPoeziiPsihologie psihiatrieSociologie


Reglarea Initierii Transcriptiei

Biologie

+ Font mai mare | - Font mai mic







DOCUMENTE SIMILARE

Trimite pe Messenger
Broastele testoase
Reglarea Initierii Transcriptiei
PERETELE CELULAR
Mitocondria. Conversia energiei celulare. Organite specializate in producerea energiei celulare.
DIVIZIUNEA CELULARA
TESTE IMUNOENZIMATICE – ENZYME IMMUNOASSAY – EIA/ ELISA
CURS BIOLOGIEMOLECULARA
Antropologia culturala in contextul stiintelor sociale
INCLUZIUNILE CELULARE
REACTIA DE PRECIPITARE

Reglarea Initierii Transcriptiei

Diapozitiv 1.



O combinatie intre experimentele genetice si biochimice la bacterii determina recunoasterea initiala a i) legarea proteinelor la secventele reglatoare asociate cu genele; ii) proteinele a caror legare la secvente reglatoare fie activeaza fie represeaza transcriptia.

Aceste componente cheie sustin (fundamenteaza) capacitatea atat a celulelor procariote cat si a celor eucariote de a activa sau inhiba (deschide sau inchide) (Turn on or turn off) cu toate ca au fost descoperite diferite variante ale procesului de baza.

Ce urmarim: un rapel al modelelor experimentale timpurii privind controlul transcriptiei bacteriene; un rapel al modului in care ARN polimerazele bacteriene initiaza transcrierea si mecanismele prin care acestea au capacitatea de a realiza acest lucru.

La bacterii, controlul genetic serveste in primul rand pentru a permite celulelor individuale sa se dapteze la schimbarile mediului nutritional astfel incat cresterea si diviziunea sa fie optimizate.

Astfel, primele orientari ale cercetarilor s-au indreptat catre genele care codifica proteine a caror producere variaza in functie de statusul nutritional al celulelor.

Desi controlul genetic al organismelor multicelulare implica adesea raspuns la modificarile de mediu, este foarte caracteristic si adesea scopul biologic esential il reprezinta reglarea unui proces genetic care sustine deyvoltarea embrionara si diferentierea tisulara. Mai mult, majopritatea principiilor controlului transcriptional au fost mai intii descoperite la bacterii si apoi aplicate/adaptate celulelor eucariote 

Diapozitiv 2.

Figura:

Cand represorul lac se leaga la secventa numita operator (O), care se leaga chiar an amonte de gena lacZ, transcriptia operonului de catre ARN polimeraza este blocata. Legarea lactozei la represor determina o modificare conformationala a represorului astfel incat acesta nu se mai leaga la operator. ARN polimeraza este apoi libera sa se lege la promotor (P) si initiaza transcriptia genelor lac; ARNm policistronic rezultat este tradus in proteinele codificate.

Diapozitiv 3

Figura: Demonstratie experimentala ca mutatiile Oc actioneaza in cis

Celulele E. Coli care contin doua copii ale operonului lac sunt prezentate in diagrama. Liniile diagonale indica genele si regiunile de control purtatoare de mutatii. In aceste celule, operonul lac al cromozomului bacterian si prezinta o mutatie Oc la nivelul operatorului si o mutatie in gena lacZ (gena lacZ-) care inactiveaza enzima beta-galactozidaza. Operonul lac din plasmida F este de tip salbatec. (Top) In absenta inductorului IPTG, aceste celule exprima constitutiv o permeaza functionala dar nu si o beta-galactozidaza. Aceste rezultate indica ca mutatia Oc afecteaza numai genele ale aceluiasi ADN. Daca mutatiile Oc ar fi actionat in trans, transcriptia genei lacZ+ din plasmida F ar fi condus la o activitatea beta-galactozidazica observabila (in partea de jos). In prezenta IPTG, sun observate atat activitate galactozidazica cat si permeazica. Asa cum se poate constata din diagrama, transcriptia genei lacZ normale (salbatice) din plasmida F conduce la o beta-galactozidaza functionala.

Diapozitiv 4

Figura: demonstratie experimentala ca gena lacI+ actioneaza in trans.

 Celulele care poseda o singura gena lacI- produc un represor inactiv, si au ca rezultat expresia constitutiva a beta-galactozidazei si permeazei. Daca o gena salbateca lacI+ prezenta in plasmidele factor F este introdusa in celule lacI-, celulele transformate produc un represor functional, care se poate lega la operatorii lac. Ca rezultat aceste celule nu exprima beta-galactozidaza sau permeaza (lacto-permeaza) in absenta inductorului.

Diapozitiv 5

Figura: demonstratie biochimica ca inductorul determina cresterea transcriptiei operonului lac.

Esantioane de celule de E. Coli crescute pe mediu de glucoza, au fost prelevate inainte si la scurte intervale dupa adaugarea IPTG. Uridina marcata cu tritiu a fost adaugata fiecarei probe imediat dupa prelevare. Dupa 20 de secunde celulele au fost lizate si a fost izolat ARN. Fiecare proba marcata a fost hibridizata cu un exces de ADN clonat fixat pe membrana. Radioactivitatea ramasa pe menbrana este o masura a vitezei de sinteza a ARNm in timpul perioadei scurte de marcare. Procentajul total de ARN marcat cu tritiu care hibridizeaza cu ADN lac in raport cu timpul dupa adaugarea IPTG indica ca proportia sintezei de ARNm creste rapid dupa adaugarea IPTG, ajungand la o rata maximala dupa doua minute.

Diapozitiv 6  Concluzii

Multe proteine bacteriene sunt inductibile, sinteza lor fiind dependenta de statusul nutritional al celulelor. Expresia diferentiala a genelor care codifica astfel de proteine apare cel mai adesea la nivelul initierii transcriptiei;

            In concordanta cu modelul Jacob si Monod privind controlul transcriptiei, transcriptia operonului lac, care codifica trei proteine inductibile este represata de legarea proteinei represoare lac la secventa operator. In absenta lactozei sau a altor inductori represia este inlaturata si operonul lac este transcris;

            Mutatiile la nivelul promotorului, la care se leaga ARN polimeraza, sau la nivelul operatorului actioneaza in cis; aceasta inseamna ca ele afecteaza numai expresia genelor de pe aceeasi molecula de ADN in care apare mutatia;

            Mutatiile in secventa unui operator care scad legarea unui represor au drept rezultat o transcriptie constitutiva. Mutatiile in secventa promotorului, care afecteaza afinitatea de legarea a ARN polimerazei, pot fie sa scada (mutatie “down”) fie sa creasca (mutatie “up”) transcriptia;

            Represorii si activatorii actioneaza in trans; ei afecteaza expresia genelor reglate de ei indifent de pozitionarea moleculei de ADN in celula.

Diapozitiv 7 - Intierea transcriptiei la bacterii

Ø                  ARN polimeraza initiaza transcriptia majoritatii genelor la nivelul unei pozitii unice situata in amonte de secventa codanta;

Ø                              Perechea de baze la nivelul careia se initiaza transcriptia este denumita “situs de initiere a transcriptiei” sau Punct START;

Ø                              Prin conventie, situl de initiere a transcriptiei de pe secventa ADN este desemnata cu pozitia +1, bazele situate in sensul transcriptiei (downstream) sunt desemnate cu numere pozitive iar cele pozitionate in sens opus (upstream) sunt asimilate cu numere negative;

Ø                              Diferitele proteine (ARN polimeraze, activatori, represori) interactionedaza cu ADN la nivelul promotorului sau in vecinatatea acestuia pentru a regla initierea transcriptiei

Diapozitiv 8. Interactiunile proteine-ADN identificate prin tehnica “footprinting

Figura: Technica Footprinting cu DN-aza I comuna pentru identificarea situsurilor de legare a proteinelor la ADN.

Un fragment de ADN care este marcat la unul din capete cu 32P (bilele rosii) ca si in metoda de secventiere Maxam si Gilbert. Portiuni din proba sunt apoi digerate cu DN-aza I in prezenta si in absenta unei proteine care se leaga la o secventa specifica din fragment. DN-aza I hidrolizeaza aleator legaturile fosfodiester. La concentratii scazute DN-aza I  este utilizata astfel incat fiecare molecula de ADN este clivata numai o data. In absenta proteinelor care se leaga la ADN, proba este clivata la toate pozitiile posibile intre capatul marcat si nemarcat al moleculei. Cele doua probe de ADN sunt apoi separate de proteine, denaturate pentru desfacerea catenelor si supuse electroforezei. Gelul rezultat este supus electroforezei si supus autoradiografiei pentru a detecta numai catenele marcate si pentru a identifica fragmentele care se intind de la capatul marcat pana la locul de actiune al DN-azei I.

In dreapta aveti o autoradiograma unde sunt analizate doua fragmente de ADN in absenta si in prezenta unor proteine de legare la ADN dupa digestia cu DN-aza I. Pentru proba diferata in prezenta proteinelor de legare la ADN se observa lipsa a doua benzi; acestea corespund regiunii protejate de digestie prin legarea proteinelor (spunem ca am realizat un footprinting privind legarea acestei proteine). Aceasta regiune de protectie poate fi foarte usor aliniata cu secventa ADN daca se realizeaza o reactie de secventiere a produsilor initiali si a celor care s-au obtinut in urma protectiei furnizate de legarea proteinelor. Reactiile de secventiere si fragmentele rezultazte in urma actiunii DN-azei sunt trecute pe acelasi gel.

Diapozitiv 9. Identificarea interactiilor proteine-ADN prin tehnica “gel-shift assays

Figura: Rezultatele unei determinari ale mobilitatii eledctroforetice prin tehnica de “intarziere in gel” pentru proteinele care se leaga la ADN (EMSA-Electrophoretic Mobility Shift Assay).

In acest exemplu, fractii ale unei coloane cromatografice de schimb ionic au fost analizate pentru proteinele care se leaga la regiunea promotoare a unei gene pentru ARNt de la EK. Un esantion al fractiei proteice este incarcata pe o coloana (ON) iar fractiile eluate de pe coloana la concentratii saline crescute (numerele fractiilor) au fost incubate cu o sonda (fragment de restrictie) radiomarcata care include regiunea promotoare; fiecare proba a fost apoi supusa electroforezei intr-un gel de poliacrilamida. Sondele libere care nu se leaga la proteine migreaza in fata. O proteina prezenta in fractiile 7 si 8 eluate de pe coloana se leaga la sonda, formand un complex ADN-proteina care migreaza mult mai lent decat sonda libera

Diapozitiv 10. Evidentierea pozitionarii ARN polimerazei la nivelul regiunii control a represorului lac prin tehnica “footprint”

Figura: Imagine “footprint” a legarii ARN polimerazei si a represorului lac la regiunea control al ADN lac

Deoarece DN-aza I cliveaza unele legaturi fosfodiester mai frecvent decat altele, densitatea benzilor in absenta proteinelor (linia 3) nu sunt la fel de uniforme ca si din figura din slide-ul 8. Parantezele din dreapta indica regiunile ADN protejate de catre digestia cu DN-aza I prin legarea ARN polimerazei (linia 4) sau a represorului lac (linia 5). Liniile 1 si 2 arata produsii celor doua reactii de secventiere Maxam si Gilbert: de pe aceste linii, benzile din gel pot fi corelate cu secventa nucleotidica a regiunii de control lac. Pozitiile in secventa sunt notate pe partea stanga; capetele sagetilor indica directia transcriptiei. Experimrentul “footprinting” a fost realizat ci marcate la capatul 5’ al capatului din dreapta al catenei superioare ca si in slide-ul 6. 

Diapozitiv 11. Regiunea control a operonului lac contine 3 situri critice “cis-acting

Figura: Diagrama regiunii de control a transcriptiei a operonului lac.

Regiunea codanta a beta-galactozidazei N terminale este catre dreapta, si regiunea codanta C-terminala a represorului lac este in stanga. Regiunile protejate de digestia cu DN-aza I (footprints) de catre cAMP-CAP, ARN polimeraza si represorul lac sunt indicate prin barele colorate de deasupra. Analizele mutationale identifica trei regiuni critice cu actiune in cis: doua in promor (regiunea galbena de la –35 la -10) si una intre +1 la +20 situata la nivelul operatorului (in maron).

Regiunea “footprint” represoare se suprapune capatului din amonte a  regiunii “footprint” a ARN polimerazei dar nu este prea mare. Experimente similare de “footprint” au demonstrat ca o a treia proteina, numita CAP care se complexeaza cu cAMP ( cAMP-CAP) se leaga de asemenea la regiunea de control lac. Complexul cAMP-CAP activeaza transcriptia de la nivelul promotorului lac.

Diapozitiv 12. ARN polimeraza se fixeaza specific la nivelul secventelor promotorului pentru a initia transcriptia

Figura: reprezentarea schematica modului de legare la ADN a formei majore a ARN polimerazei de la E. Coli.

Prin conventie, situsul de initiere a transcriptiei este numerotat, in general, cu +1. Perechile de baze care se extind in directia transcriptiei sunt numite “downstream”, in aval, fata de situsul de initiere a transcriptiei; cele care sunt extinse in regiunea inversa sunt considerate “unstream” sau in amonte. Subunitatea sigma70 se leaga la secvente specifice situate langa pozitiile –10 la –35 ale promotorului. Subunitatile alfa se leaga strans la ADN din amonte, iar beta si beta’ sunt asociate punctului de start.

Diapozitiv 13. Diferentele de la nivelul secventelor promotorului E. coli afecteaza frecventa initierii transcriptiei

Figura: Promotorii recunoscuti de catre ARN polimeraza (continand secventa sigma70) de la E. Coli.

a)      Secventele unor promotori “puternici” cu spatii (puncte) introduse pentru a maximiza omologia la nivelul regiunii –10 la –35. Aceste secvente corespund catenei sens (de sus) a promotorului in conditiile in care procesul de transcriptie se realizeaza de la stinga la dreapta. Bazele care corespund secventei consens din regiunea –35 la –1o sunt colorate in galben. Sase dintre secvente corespund secventelor control ale genelor care codifica pentru ARN. Secventele din structura regiunilor promotoare ale Lambda, T7 si fd, care sunt prezente in genoame virale care sunt direct transcrise de catre ARN polimeraza celulei gazda.

b)       Secventele consens ale regiunilor –35 la –10, care sunt separate de 15-17 pb.

Sunt descrise mutatiile cunoscute ca descrescand semnificativ frecventa transcriptiei unui anumit numar de promotori. In secventele consens, frecventa cu care bazele indicate apar la fiecare pozitie la diferiti promotori sigma70 este indicata dupa cum urmeaza: litere in rosu: > 70%; litere boldite negre: 50-70%; litere negre: 40-50%.

c) secven’ele regiunilor /35 la /10 ale promotorului lac care sunt diferite de secventa consens in patru pozitii (in albastru) Mutatiile “down” determina scaderea expresiei operonului lac. Cele doua mutatii “up” care cresc gradul de asemanare a regiunii –10 cu secventa consens, cresc expresia.

Diapozitiv 14. Majoritatea secventelor operator sunt scurte repetitii inversate

Figura: Secventa operatorului lac reprezinta o secventa repetitiva inversata aproape perfecta centrata in jurul unei secvente GC situata in pozitia 11.

 Secventa de 17 pb de pe catena sens care incepe la –7 este identica cu secventa de 17 pb situata pe catena antisens si incepe la +28, cu exceptia nucleotidelor indicate in italic. Fiecare din aceste secvente repetitive este denumita “jumatate de situs operator”.

Diapozitiv 15. Majoritatea represorilor bacterieni sunt structuri dimere care contin elice a care se insereaza in fosele majore adiacente ale ADN

Figura: Modele privind represorul bacteriofagului 434 si interactiunea sa cu ADN

Acesta si multi alti represori bacterieni sunt homodimeri care insereaza un helix alfa (helixul de recunoastere) al fiecarui monomer intr-o fosa majora a operatorului ADN. Represorii bacteriofagilor se leaga la secventele operator din genomul viral prevenind astfel transcriptia de catre ARN polimeraza celulei tinta.

a)      Modelul cu bile (space-filling model) al represorului dimer 434 legat la operatorul sau ADN specific

b)       Modelul paglica al monomerului superior (de sus) al represorului dimer 434 aratand interactia sa cu ADN. Trei resturi de glutamine (Q), o serina (S) si o treonina (T) in helixul de recunoastere formeaza legaturi de hidrogen cu bazele din fosa majora a ADN operator;

c)       Diagrama “in fire” demonstrand interactiile dintre ADN si monomerul inferior si interfata dimerului in represorul 434. Punctele rosii indica legaturile de hidrogen si ionice dintre represor si ADN. Cercurile mici reprezinta molecule de apa legate

Diapozitiv 16. Modificarile conformationale induse de liganzi modifica afinitatea multor represori pentru ADN

Figura: Modificari conformationale in structura apo-represorului cauzate de legarea triptofanului.

            Elicele alfa din proteina dimera, reprezentate ca cilindri, sunt identificate prin literele majuscule intr-un monomer si literele minuscule in celalalt. Elicele de recunoastere (E si e) sunt prea apropiate apropiate pentru a intra in fosele majore adiacente ale operatorului ADN. Cand aporepresorul leaga triptofanul, capetele N terminale ale elecelor E si e se deplaseaza ciu 8 A. Drept rezultat elecele E si e din represor impreuna cu triptofanul legat (in portocaliu) se orienteaza (se dispun) in operatorul ADN. 

Diapozitiv 17. Controlul pozitiv al operonului lac este exercitat de catre cAMP-CAP

Figura: Control transcriptional pozitiv si negativ al operonului lac de catre represorul lac si respectiv cAMP-CAP

a)      In absenta lactozei, nu se formeaza ARNm lac deoarece represorul se leaga la operatorul lac si impiedica trancriptia;

b)       In prezenta glucozei si lactozei, represorul lac se leaga la lactoza si sufera modificari conformationale si astfel nu se mai poate lega la operatorul lac.  Totusi, cAMP este scazut, deoarece glucoza este prezenta si atunci complexul cAMP-CAP nu se leaga sitului CAP de pe operator. Ca rezultat, ARN polimeraza nu se leaga eficient la promotorul lac si este sintetizat numai putin ARNm lac;

c)       In prezenta lactozei si in absenta glucozei, apare transcriptie maxima la nivelul operonului lac. In aceasta situatie, represorul lac nu se leaga la operatorul lac, concentratia cAMP creste si coplexul cAMP-CAP format se leaga la situsul CAP, stimuland legarea si initierea de catre ARN polimeraza.

Diapozitiv 18. Legarea cooperativa a cAMP-CAP si a ARN polimerazei la regiunea de control a lac activeaza transcriptia

Figura: Legarea cooperativa a ARN polimerazei de la E. Coli si a complexului cAMP-CAP la promotorul lac.

Prin ele insale, ARN polimeraza si cAMP-CAP poseda afinitati relativ reduse pentru situsurile lor de legare la promotorul lac. Totusi, interactia dintre regiunile CAP si subunitatea alfa a ARN polimerazei formeaza un complex proteina-proteina care se leaga mult mai stabil la promotorul ADN decat fiecare dintre cele doua proteine singura.

Diapozitiv 19. Model de legare a cAMP-CAP la secventa promotoare lac promoter

Figura: Modelul cu bile de legare a complexului cAMP-CAP la promotorul lac

CAP leaga ADN dublu helix in jurul suprafetei sale. Cand exista resturi de aminoacizi mutante complexul cAMP-CAP nu mai activeaza transcriptia de la nivelul promotorului lac. Secventa ADN situata la extremitatea complexului reprezinta regiunea din apropierea pozitiei –50 unde capatul C terminal al unei subunitati alfa se considera ca interactioneaza resturile mai inchise la culoare din structura CAP.

Diapozitiv 20. Transcriptia de la nivelul unor promotori este initiata de factorii sigma (s) alternativi

Tabel: Transcriptia majoritatii promotorilor de la E. Coli este demarata prin interactia promotorilor cu ARN polimeraza care contine factorul sigma70. Transcriptia anumitor grupe de gene, totusi, este realizata de catre ARN polimeraze care contin una sau mai multe alternative de factori sigma: sigma28, sigma32, sigma38 si sigma54-care recunosc secvente promotor consens diferite de sigma70. Atat sigma28 si sigma32 prezinta regiuni de omologie cu sigma70 si recunosc secvente situate tot in intervalul –35 la –10.

Diapozitiv 21. Activarea subunitatii s54 a ARN polimerazei la nivelul promotorului glnA de catre NtrC

Figura: Activarea subunitatii sigma54 a ARN polimerazei la promotorul glnA de catre NtrC (Nitrogen regulatory Protein)

glnA este o gena care codifica pentru enzima glutamin sintetaza care sintetizeaza glutamina pornind de la acidul glutamic si amoniac.

Polimeraza se leaga la promotorul glnA, formind un complex unit (strans), inainte de activare. Ca raspuns la concentratiile mici de aztot organic, o protein kinaza numita NtrB fosforileaza proteina dimera NtrC (purpurie) care apoi se leaga la doi “enhancers” (portocaliu) pozitionati la –108 si –140 fata de situsul de START al transcriptiei. Dimerii NtrC fosforilati legati interactioneaza cu subunitatea sigma54 legata determinand formarea unei bucle la nivelul ADN implicat. Activitatea ATP-azica A NtrC stimuleaza apoi polimeraza sa desfaca catenedle la situsul de start, formand un complex deschis. Transcriptia genei glnA poate sa inceapa.

Diapozitiv 22. Vizualizarea buclei ADN si a interactiilor legarii NtrC si subunitatii s54 a polimerazei

Figura: Vizualizarea buclei ADN si interactiilor Ntrc si a subunitatii sigma54 a polimerazei

a)      Micrografie electronica a fragmentului de restrictie ADN cu cei doi dimeri NtrC fosforilati legati la regiunea enhancer langa unul din capetele subunitatii sigma54 a polimerazei legata la promotorul glnA langa celalat capat.

b)       Micrografie electronica a aceluiasi fragment demonstrand legarea dimerilor NtrC si a subunitatii sigma54 a polimerazei unul cu altul cu formarea buclei de ADN intre acestia.

Diapozitiv 23. Multre raspunsuri bacteriene sunt controlate de sisteme reglatoare bi-componente

Figura: Sistemul bicomponent reglator PhoR/PhoB de la E. Coli

 Ca raspuns la concentratiile scazute de fosfati din mediu si spatiul periplasmic, un ion fosfat disociaza din domeniul periplasmic a proteinei senzor PhoR (portocaliu). Aceasta determina o modificare conformationala care activeaza un domeniu transmitator al unei protein kinaze din regiunea citosolica a PhoR. Domeniul transmitator activat transfera un un gama-fosfat din structura ATP unui rest de histidina conservat din structura domeniului transmitator. Acest fosfat este apoi transferat unui acid aspartic din domeniul receptor al regulatorului raspunsului ProB (purpuriu). Mai multe proteine ProB pot fi fosforilate de catre una activata ProR. Proteinele fosforilate ProB activeaza apoi transcriptia de la gbenele care codifica proteine care ajuta celula sa raspunda la cantitatea mica de fosfat, incluzand phoA, phoS, phoE si ugpB.

Diapozitiv 24. Concluzii

ARN polimerazele sunt proteine mari compuse din subunitati beta, beta’ si doua subunitati alfa care formeaza “core” polimeraza si o subunitate sigma, din cateva alternative, care functioneaza ca factor de initiere;

            Initierea incepe cand subunitatea sigma a moleculei de polimeraza se leaga la secventa promotor, formand un complex unit. Polimeraza separa apoi catenele pe o distanta de 12-13 pb la nivelul situsului de start a transcriptiei, formand un complex deschis. Dupa ce aproximativ 10 ribonucleotide au fost polimerizate, subunitatea sigma este eliberata si “core” polimeraza continua transcriptia matritei;

            “Puterea” unui promotor se refera la cat de frecvent ARN polimeraza initiaza transcriptia pornind de la acesta. Subunitatea sigma70, factorul major in initiere la E. Coli, interactioneaza cu secventele promotor situate in regiunea –10 la –35 fata de situsul de start;

            Represorii se leaga la secventele de ADN numite operatori, care se suprapun partial cu regiunea promotoare  la nivelul careia se leaga ARN polimeraza. Legarea represorului interfera cu legarea ARN polimerazei si cu initierea transcriptiei;

            Activatorii subunitatii sigma70 a ARN polimerazei se leaga, in general, la ADN pe partea opusa a helixului fata de polimeraza, in regiunea –20 la –50, sau chiar in amonte de polimeraza, in apropierea –60;

           

Diapozitiv 25 Concluzii

Activatorul cAMP-CAP stimuleaza transcriptia prin formarea unui complex cu ARN polimeraza care prezinta o mai mare afinitate pentru situsuri ADN specifice decat proteinele individuale. In plus fata de stimularea legarii polimerazei, activatorii pot stimula si formarea complexului deschis si inceperea transcriptiei;

            Multi represori bacterieni sunt dimeri. Fiecare monomer contine un alfa-helix care se insereaza in fosa majora a operatorului ADN, astfel incat dimerul se leaga la fose majore succesive. Afinitatea mare de legare este rezultatul formarii multor legaturi de hidrogen, ionice si van der Waals dintre proteine si secvente ADN specifice;

            Secventele de ADN care leaga proteinele reglatoare dimere sunt secvente repetitive inverse, care reprezinta fiecare jumatati de situsuri care leaga un monomer;

            Operonii transcrisi de catre subunitatea sigma54 sunt reglate prin activatori care se leaga la secvente “enhancer” de aproximativ 100 pb in amonte de situsul de initiere. Secventele “enhancer” care leaga activatori inetractioneaza tranzitoriu cu polimeraza echilibrata legata la nivelul promotorului, stimuland formarea unui complex deschis si intierea transcriptiei;

            In sistemele bi-componente reglatoare, o proteina actioneaza ca un senzor, monitorizand nivelul de nutrienti din mediu. In conditii adecvate, proteina senzor activeaza o a doua proteina, reglatorul raspunsului, care se leaga apoi la secventele reglatoare, stimuland sau represand astfel transcriptia genelor specifice. 

Diapozitiv 26. Controlul genelor eucariote: scop si principii generale

Ø      Spre deosebire de celulele bacteriene si eucariotele  unicelulare, celulele organismelor pluricelulare au relativ putine gene reglate reversibil de conditiile de mediu;

Ø      Controlul genetic al organismelor pluricelulare este important pentru dezvoltare si diferentiere si,

Ø      In general, nu este reversibil

In interiorul unei celule bacteriene singulare, genele sunt reversibil induse si represate prin control transcriptional pentru a ajusta masinaria enzimatica celulara mediului inconjurator nutritional si fizic. Eucariotele monocelulare, cum sunt drojdiile, poseda si ele multe gene care controleaza raspunsul la variatia mediului (cum ar fi statusul nutritional, tensiunea de oxigen si temperatura). Chiar in organele organismelor superioare, de exemplu, ficatul mamiferelor unele gene pot raspunde reversibil la stimulii externi cum sunt noxele chimice. Totusi, in general celulele eucariotelor pluricelulare sunt protejate de influentele externe imediate; adica majoritatea celulelor isi desfasoara activitatea intr-un mediu constant. Probabil, din acest motiv genele care raspund schimbarilor de mediu contrituie o fractie mult mai mica din numarul celulelor unui organism multicelular decat in organismul unicelular.

            Cea mai importanta caracteristica a controlului genetic la organismele multicelulare este exactitatea executiei deciziei  precise de dezvoltare astfel incat gena necesara sa fie activata intr-o anumita celula la un anumit moment din dezvoltarea organismului care contine un numar mare de tipuri celulare. In majoritatea cazurilor o data ce etapa de dezvoltare a fost depasita de o celula, ea nu este reversibila. Astfel, aceste decizii sunt fundamental diferite de inductia sau represia bacteriana. In executarea programului lor genetic, multe tipuri celulare diferite (ex, celulele din piele, celulele rosii din sange, celule producatoare de anticorpi, etc) marcheaza o cale catre moartea celulara finala. Profilele determinate ale controlului genetic care conduc la diferentiere servesc necesitatile intregului organism si nu supravietuirii individuale a celulei.     

Diapozitiv 27 La eucariotele superioare reglarea multor gene se realizeaza prin controlul transcriptiei

Figura: Determinarea ratei de transcriptie a lanturilor in formare ale unei gene prin tehnica “run-on”

            Nucleii izolati au fost incubasi cu 32P-ribonucleotid trifosfati pentru o perioada scurta. In timpul acestei perioade moleculele de ARN polimeraze care transcriu o gena cand nucleii sunt izolati adauga 300-500 nucleotide lanturilor de ARN in formare. Apar foarte putine reactii de initiere. Prin hibridizarea ARN marcat cu ADNc pentru o gena specifica (A in acest caz), poate fi masurata fractia de ARN total produsa de pe aceasta gena (deci transcriptia sa relativa).

            Masuratorile dirtecte ale ratelor de transcriptie ale mai multor gene in diferite tipuri celulare au aratat ca reglarea initierii transcriptiei este forma universala a controlului genetic la eucariote ca si la bacterii. Cea mai simpla si mai directa metoda de a masura ratele de transcriptie este aceea de a expune celulele pentru un timp foarte scurt (de exemplu 5 minute sau mai putin) unui precursor ARN marcat (ribonucleotid) si apoi sa se determine cantitatea de ARN nuclear marcat format prin hibridizarea sa cu un ADN clonat.  Aceasta metoda poate fi folosita pentru a determina ratele de transcriptie in culturile de celule dar nu si in intregul organism deoarece cantitatea de ARN marcat obtinut este insuficienta pentru masuratori de acuratete. Chiar si in celulele cultivate, o a doua metoda numita “ analiza produsului in formare”(nascent-chain analysis) sau (“run-on” analysis) este adesea preferata.  In aceasta metoda, nucleii sunt izolati din celule si permit incorporarea 32P din ribonucleotid trifosfat in catenele de ARN in formare. Vitezele relative de transcriptie determinate fie prin marcarea culturilor de celule sau a nucleilor izolati sunt aproximativ aceleasi, inbdicand ca moleculele de polimeraze care sunt active la nivelul nucleilor chiar daca sunt scoase din mediul celular

Diapozitiv 28. Sinteza diferentiata a 12 molecule ARNm codificate specific de gene hepatice

Figura: Demonstractie experimentala a sintezei diferentiale a12 moleculele de ARNm care codifica proteine hepatice specifice

            Nucleii din ficat, rinichi, celule din creier de soarece au fost expuse la 32P-UTP, si ARN marcat rezultat a fost hibridizat cu diferite molecule de ADNc fixate pe nitroceluloza. Dupa indepartarea ARN nehibridizat, hibrizii au fost evidentiati prin autoradiografie. Moleculele de ADNc marcate codifica pentru 1-12 proteine sintetizate activ in ficat (de exemplu 4 = albumina, 3 = alfa1-antitripsina, 6 = transferina) dar nu in majoritatea celorlalte tesuturi. Celelalte molecule de ADNc testate au fost actina (A), alfa- si beta-tubulina (aT si bT), care sunt proteine ce se detecteaza in majoritatea tipurilor celulare. ARNt pentru metionina si ADN plasmidial (pB) in care ADNc au fost clonate au fost folosite drept control. Intensitatea spoturilor generata prin hibridizarea ARN sintetizat in timpul transcriptiei “run-on” in vitro izolati dincele trei  tesuturi indica ca genele care se exprima specific in hepatocite sunt transcrise in ficat dar nu sunt transcrise in celulele altor tesuturi. 

            Rezultatele analizelor “run-on”  sunt ilustrate in figura de mai sus si demonstreaza ca transcriptia multor gene care care codifica proine exprimate specific in hepatocite (celulele majore ale ficatului mamiferelor) este intradevar detectata si in nucleii preparati din ficat, dar nu si in nucleii izolati din creier si rinichi. Analizand masuratorile sintezelor de ARN din timpul dozarilor “run-on” , aceste rezultate indica ca sintezele diferentiale ale proteinelor specifice ficatului sunt reglate de factori de control a transcriptiei genelor corespunzatoare in diferite tesuturi. Rezultate similare au fost obtinute in experimentele “run-on” realizate pe alte tipuri celulare si pe o larga varietate de proteine tesut-specifice, indicand ca controlul transcriptional este comun in organismele complexe. 

Diapozitiv 29. Elementele reglatoare la eucariote

Ø      Reprezinta adesea mii de kilobaze in amonte sau in aval de START;

Ø      Principiile de baza care controleaza transcriptia la bacterii exista si la eucariote: transcriptia este initiata la nivelul unei regiuni specifice si este controlata de legarea proteinelor “trans-activatoare” (factori de transcriptie) la secventele “cis-activatoare” din structura ADN;

Ø      Elementele “cis-activatoare” sunt adesea mult mai departe de promotorul pe care il regleaza, transcriptia la nivelul unui singur promotor poate fi reglata prin legarea mai multor factori de transcriptie la elementele de control alternative;

Ø      Secventele care controleaza transcriptia pot fi identificate prin analize de deletie in serie la capatul 5’.  

Genele procariote si eucariote sunt structurate dupa aceeasi logica de baza, dar cu diferente importante in detaliile moleculare. O definitie sintetica a unei gene eucariote poate fi utila pentru a rezuma esenta acestor diferente. Este general admis ca o singura definitie data genei eucariote nu poate satisface pe toata lumea sau sa corespunda la toate exemplele. Cea pe care am adoptat-o este rezultatul structurii moleculare a genelor care asigura o gama larga de functiuni in diverse organisme eucariote. Definitia tine cont de diferentele de localizare si de tipurile de secvente care influenteaza expresia genelor. Aceasta presupune implicit ca mutatiile fenotipice observabile sunt rezultatul modificarilor la nivelul semnalelor de reglare dar si in secventele codante.

            Definim gena ca fiind o combinatie de segmente de ADN care, impreuna, constituie o unitate de expresie, o unitate care determina formarea unui produs specific si functional al genei si care poate sa fie o molecula de ARN sau un polipeptid. Segmentele de ADN care definesc gena includ:

            1. Unitatea de transcriptie care este constituita dintr-un segment ADN continuu care codifica pentru secventa transcriptului primar; acesta include: a) secventa codanta a ARN matur sau a proteinei produse, b) intronii si c) secventele leader 5’ si coada 3’ prezente la nivelul ARNm matur ca si secventele de separare care sunt eliminate in timpul maturarii trannscriptilor primari care codifica pentru ARN.

            2. Secventele minimale necesare pentru initierea corecte a transcriptiei (promotorul) si pentru a da nastere extremitatii 3’ particulare din structura ARN matur.

            3. Elementele secventei care determina frecventa de initiere a transcriptiei; acestea cuprind secventele responsabile de inducerea si represia transcriatiei si de specificitatea celulara, tisulara si temporala a transcriptiei. Aceste regiuni sunt foarte variate structural, ca pozitie si ca functie pentru a putea purta un singur nume. Dintre acestea enumeram elementele activatoare (enhancers) si elementele moderatoare (silencers), care sunt secvente ce influenteaza initierea transcriptiei la distanta, independent de localizarea lor in raport cu situsul de initiere.

            In aceasta definitie a genei nu sunt incluse secventele ADN care influenteaza configuratia unei gene in cromatina si nici cele care codifica proteine sau ARN care moduleaza expresia unei anumite unitati de transcriptie.

            Caracteristicile esentiale ale unei gene eucariote tipice care codifica pentru o proteina sunt descrise in figura 8.3. In aceasta reprezentare, inceputul genei este in stanga si capatul in dreapta, in acord cu conventia generala admisa de reprezentare a transcriptiei. Aceasta semnifica ca bratul de ADN care are aceeasi structura cu ARN transcris, este bratul sens 5’-3’ orientat de la stanga la dreapta si este in general reprezentat ca bratul superior. Matricea de transcriptie, catena antisens este orientata 3’-5’ de la stanga la dreapta (bratul inferior). Pentru a usura schemele, catena sens este adesea singura reprezentata. Pozitia primei nucleotide in molecula transcript este notata +1, iar nucleotidele situate in aval in unitatea de transcriptie sunt numerotate pozitiv (ex. +16). Nucleotidele care sunt in amont de +1 (secventa netranscrisa) sunt desemnate cu numere negative (ex. -25).

            O modalitate usoara de a examina relatia care exista intre noile caracteristici structurale ale genelor eucariote si expresia si reglarea lor consta in a pleca de la exemple de gene reprezentative in contextul ARN polimerazei care initiaza expresia acestora. Astfel, vor fi discutate pe rand caracteristicile structurale ale genelor de clasa I, clasa II si clasa III; caracteristicilor ARN polimerazelor respective; mecanismele de reglare a transcriptiei. Maturarea transcriptilor primari ARN, in particular mecanismul procesului de excizie-episaj care determina producerea ARNm, ARNr si ARNt. Intr-o alta sectiune vor fi examinate motivele structurale care permit factorilor de transcriptie proteici sa interactioneze cu secvente specifice din structura ADN si intre ei. Capitolul se va termina cu examinarea mecanismelor cele mai generale de reglare, si anime cele care influenteaza reinnoirea ARNm, si a modului in care blocuri mari de gene sunt reglate prin modificarea ADN sau a cromatinei in care genele sunt impachetate.

Diapozitiv 30. Secventele promotoare ale mai multor gene structurale eucariote

Figura: Secventele promotoare ale unor gene eucariote. Segmentul omolog, TATA box, este colorat in rosu si prezinta proportiile diferitelor baze precunm si secventa consens cea mai probabila.    

            Din cursul anterior

            Fenotipul unui organism sau a unei celule diferentiate este, in mare masura, determinat de cantitatea si de varietatea proteinelor pe care acesta (aceasta) le contine. Acest lucru reflecta, in general, concentratia si natura ARNm sintetizate. Principalul mecanism responsabil de diferitele fenotipuri este deci expresia diferentiata a genelor din clasa II. Aceasta relatie fundamentala intre expresia genelor si fenotip a fost stabilita prin masuratori comparative ale cantitatii proteinelor si ale cantitatii ARNm in diferite stadii ale dezvoltarii unui organism in diverse tesuturi diferentiate ale aceluiasi organism si chiar in celule identice aflate in stadii fiziologice diferite.

            In principiu, dar si in realitate, reglarea expresiei unei gene poate sa intervina in orice etapa a biogenezei ARNm sau la traducerea acestuia in proteina. O serie de experimente indica ca determinantul esential al nivelului ARNm este initierea transcriptiei. Acest proces este reglat in principal prin interactia elementelor secventei (elementele cis) prezente la nivelul situsului de initiere sau la distante variabile de acesta, cu o colectie de proteine specifice (factori de transcriptie care actioneaza in trans) dintre care cea mai mare parte recunosc secvente particulare de ADN. Astfel, atat reglarea temporala a transcriptiei cat si reglarea sa specifica in functie de tesut sunt determinate de prezenta si cantitatea diferitilor factori care actioneaza in trans. Viteza si natura procesului de excizie-episaj a pre-ARNm reprezinta cel de al doilea mecanism important care contribuie la reglarea nivelului ARNm. Degradarea diferentiala a moleculelor ARNm influenteaza si ea expresia anumitor gene. Transportul moleculelor de ARNm din nucleu catre citoplasma poate sa participe si el la controlul expresiei genelor ce codifica pentru proteine, cu toate pana in prezent exista destul de putine date care sa sustina aceasta ipoteza. In plus, chiar traducerea ARNm poate fi reglata in acest sens existand multe date probatorii. Degradarea selectiva a proteinelor contribuie si ea la reglarea nivelului lor, dar importanta acestui proces nu este inca clarificata. Daca proportia de re-innoire a unei proteine influenteaza echilibrul concentratiei unui component critic al masinariei de traducere, de exemplu un factor care actioneaza in trans, influenta sa poate fi mare asupra sintezei moleculelor de ARNm.

 

Diapozitiv 31. Constructia si analiza deletiilor seriate in 5

Figura: Constructia si analiza deletiilor 5’ seriate pentru a localiza secventele de control a transcriptiei situate in amonte de genele eucariote

            Un fragment de ADN (galben) care contine o regiune start a transcriptiei este clonata intr-un vector plasmidial (upper-left). Plasmida este linearizata prin digestia cu o enzima de restrictie (A) care scindeaza la capatul din amonte a fragmentului linearizat. ADN linearizat este apoi digerat cu o exonucleaza pentru diferite perioade de timp, astfel incat lungimi diferite de ADN sunt inlaturate de la fiecare capat. Dupa adaugarea unui linker oligonucleotidic si digestia cu cu enzimele de restrictie B si C, fragmentele inlaturate sunt clonate intr-un vector plasmidial care contine o gena raportor slaba (albastru deschis). Plasmidele prezentand fragmente de lungimi diferite ale regiunii din amonte (regiunea din 5’ ale situsul de demarare a transcriptiei) sunt apoi transfectate in culturi de celule (sau folosite la realizarea de animale transgenice) si este determinata expresia genei raportor. Rezultatele acestui exemplu ipotetic indica ca fragmentele testate contin doua elemente de control. Capatul 5’ al uneia este cuprins intre deletiile 2 si 3; capatul 5’ al celeilalte este corelat cu deletiile 4 si 5.

Diapozitiv 32. Sinteza moleculelor de ARN este catalizata de 3 polimeraze

Figura: Separararea si identificarea celor trei ARN polimeraze de la eucariote prin cromatografie pe coloana.

            Un extract proteic din nuclei celulelor de broasca a fost trecut pe o coloana de DEAE Sephadex pe care proteinele incarcate se absorb diferit. Proteinele absorbite sunt eluate (curba albastra) cu o solutie cu concentratie de NaCl crescanda. Fractiile care contin proteinele eluate sunt testate pentru capacitatea lor de a realiza transcriptia ADN (Curba rosie) in prezenta a patru ribonucleotid-trifosfati. A fost masurata si sinteza ARN de catre fiecare fractie in prezenta a 1microgram/ml  de alfa-amanitina (curba bleu). La aceasta concentratie alfa-amanitina inhiba activitatea polimerazei Iidar nu afecteaza pe cea a polimerazelor I si III (Polimeraza III este sensibila la 10 micrograme/ml de alfa-amanitina in timp ce polimeraza I este neafectata chiar si la concentratii mai mari) .   

            Din Cursul Anterior

            Transcriptia genelor din clasa I este realizata de ARN polimeraza I si reprezinta jumatate din activitatea de transcriptie pentru majoritatea celulelor eucariote. Singurul produs al acestei transcriptii este un precursor de ARN ribozomic (pre-ARNr), care este transformat prin clivare secventiala pentru a forma speciile de ARNr 5,8S, 18S si 28S (cel de al patrule tip de ARNr 5S este codificat de catre o gena din clasa III). Numarul de gene care codifica pentru ARNr variaza de la o suta la mai multe mii, in functie de specie. Acestea sunt localizate pe unul sau pe mai multi cromozomi specifici, in regiuni morfologice distincte numite organizatori nucleolari. In timpul interfazei, aceste regiuni sunt incorporate in nucleol, structura in care moleculele de ARNr sunt transcrise activ, se transforma pre-ARNr si se asambleaza ribozomii.

            ARN polimerazele au fost purificate dintr-o mare varietate de celule utilizand metode

clasice de separare a proteinelor. Contrar ARN polimerazelor II si III localizate in nucleoplasma, ARN polimeraza I este asociata nucleolului si poate fi izolata de nucleosol. Numai ARN polimeraza I catalizeaza transcriptia grupului de gene ARNr. Specificitatea ARN polimerazei I pentru genele ARNr este sugerata de insensibilitatea sintezei ARNr si de rezistenta polimerazei I la a-amanitina.

Caracteristicile moleculelor ARN de clasa II

            Gene din clasa II codifica pentru toate moleculele de ARNm citoplasmatic moleculele ARN U din snRNP (small nuclear ribonucleoproteine), cu exceptia U6. Moleculele transcript ale genelor din clasa II poseda modificari caracteristice la extremitatea 5’ (coif): 7-metil guanozina pentru ARNm si 2, 2, 7- trimetil guanozina pentru ARN U. In ambele cazuri, guanozina metilata a coifului este legata de primul nucleotid transcris printr-o legatura trifosfat cu nucleotidele din pozitiile lor 5’. Aproape toate moleculele de ARNm poseda si o coada poliadenilata (poli A) caracteristica care debuteaza la distante diferite dincolo de sfarsitul regiunii codante; coada poli A nu este codificata de gena care a determinat obtinerea transcriptului ci este adaugata in urma unei reactii post-transcriptionale. La drojdii si alte eucariote inferioare lungimea cozii poli A este de ordinul a 75 la 185 resturi. Moleculele de ARNm nuclear de la majoritatea vertebratelor au o coada poli A de 200 la 300 nucleotide, dar extensia poli A a moleculelor ARNm citoplasmatice este mai scurta si caracteristica fiecarui tip de ARNm in parte. Din contra, multe molecule de ARNm care codifica histone sau ARN U sunt lipsite de aceasta coada. Anumite molecule ARNm contin adenin N6-metilate si toate moleculele ARN U au caracteristic un numar mare de resturi uracil modificate. Aceste modificari sunt probabil realizate in timpul sau dupa transcriptie, functiile lor fiziologice fiind necunoscute.

Cu exceptia unor cazuri foarte rare, moleculele ARNm si ARN U deriva din transcripti primari ale caror secvente sunt colineare pe intreaga lungime  cu ADN de pe care au fost transcrise. In afara de coif si clivarea extremitatii 3’ inainte de poliadenilare, principala etapa de maturare necesara formarii unei noi molecule de ARNm functionala este excizia-episajul (splicing). Cu toate ca absenta intronilor in pre-ARN U face aceasta operatie inutila, moleculele transcript primar necesita clivarea endo si exonucleotidica pentru formare extremitatilor 3’ mature.

            Moleculele de ARN transcrise de pe structura genelor din clasa III nu codifica proteine. De fapt, produsii acestora sunt molecule mici de ARN implicate in sinteza proteinelor (ARNt si ARNr 5S), in transportul intercelular al proteinelor (ARN 7 SL) si in maturarea post-transcriptionala (ARN U6). Genele din clasa III codifica si multe alte molecule de ARN al caror rol fiziologic este necunoscut (ARN 7SK, ARN Alu). Genoamele adenovirusurilor poseda doua gene de clasa III, VA1 si VA2, ai caror produsi de transcriptie (de 157 si 140 nucleotide) deturneaza masinaria de transcriptie a celulei infectate facand-o mai eficace pentru sinteza proteinelor necesare structurii virale. Doua molecule mici de ARN, EBER I si EBER II (166 si 172 nucleotide) sunt si ele produse de gene din clasa III ale genomului virusului Epstein-Barr.

            Genele din clasa III sunt repartizate in doua grupe. In prima, care codifica pentru ARN 5S si ARN 7SL, 7SK, U6 si VA, transcriptii primari au aceeasi lungime cu moleculele ARN functionale; nu exista deci maturare a acestor transcripti. Trifosfatul din pozitia 5’ rezultat in urma initieri transcriptiei reprezinta extremitatea 5’ si ultimul rest care este transcris corespunde extremitatii 3’ a ARN matur. Genele clasei III din a doua grupa codifica pentru moleculele ARNt ale caror forme mature sunt produse prin eliminarea extremitatilor 5’ si 3’ ale transcriptilor primari de catre endonucleaze specifice. Secventa -CCA 3’ terminala, necesara functionarii tuturor ARNt nu este codificata de catre gena si este adaugata de o enzima particulara. Deoarece anumite gene care codifica ARNt contin introni este necesar procesul de maturare (excizie/episaj) pentru producerea moleculelor ARNt mature.

Diapozitiv 33. Structura ARN polimerazelor eucariote determinata prin cristalografie electronica

Figura: Structurile ARN polimerazelor eucariote determinate prin cristalografie electronica.

a)       ARN polimeraza II de la drojdii la o rezolutie de aproximativ 16 A. Proteina are aprox 140x136x110 A.

b)       Este ARN polimeraza I de la drojdii la o rezolutie de aprox 30 A. Proteina are aproximativ 150x110x110 A.

Diapozitiv 34. Comparatie: subunitatile structurale ale ARN polimerazei de la drojdii si E. coli RNA

Figura: Reprezentare schematica a  subunitatilor structurale ale ARN polimerazelor de la drojdii in comparatie cu ARN polimeraza de la E. Coli.

            Toate trei polimerazele de la drojdii prezinta patru subunitati centrale (core) care exprima aceeasi omologie cu subunitatile beta, beta’ si subunitatile alfa de la E. Coli. Cea mai mare subunitate (L’) de la ARN polimeraza II  contine si domeniul C terminal (CTD). ARN polimeraza I si III contine aceleasi doua subunitati like-alfa neidentice, in timp ce ARN polimeraza II are doua copii a unei subunitati diferite like-alfa. Toate trei polimerazele prezinta alte cinci subunitati comune (doua copii ale celei mai mari dintre acestea). In plus, fiecare polimeraza din drojdie contine de la 4 la 7 subunitati mici unice.

Din cursul anterior

ARN polimeraza II

            Genele din clasa II sunt transcrise in nucleu de catre ARN polimeraza II. Enzima a fost izolata de la numeroase organisme printre care drojdiile, Physarum, Aspergilius, Acathamoeba, vegetale superioare insecte, Xenopus si mamifere. Compozitia in subunitati a enzimelor din diferite organisme este foarte asemanatoare si adesea de ne-departajat pe baza unor criterii fizice (figura 8.20). Un numar de noua sau zece subunitati pare sa fie o regula. Toate enzimele analizate contin doua subunitati mari. Una, de aproximativ 220 kD, este cea mai mare polipeptida pe care o regasim in structura celor trei tipuri de ARN polimeraze; alta de aproximativ 140 kD. Trei subunitati mici ale ARN polimeraza II sunt comune cu ARN polimeraza I si II; celelalte patru sau cinci subunitati sunt specifice enzimei. Existenta unei similitudini structurale si chimice intre cele doua subunitati mari la cele trei ARN polimeraze eucariote a fost initial suspectata datorita reactiilor imunologice incrucisate pe care acestea le dadeau si datorita existentei unor peptide comune: aceasta asemanare este acum confirmata prin compararea secventelor genelor clonate. In plus, cele doua subunitati mari ale fiecareia dintre cele trei polimeraze eucariote poseda secvente in aminoacizi cu un inalt grad de asemanare cu secventele subunitatilor mari ale ARN polimerazei de la E. coli.



            Dintre cele trei ARN polimeraze, ARN polimeraza II este cea mai sensibila la a-amanitina. Toxina permite initierea lantului de ARN dar blocheaza elongarea acestuia. Situsul de actiune al a-amanitinei pare sa fie situat la nivelul subunitatii celei mai mari. La Drosophila si la S. cerevisiae mutatiile care confera rezistenta la amanitina sunt localizate in gena care codifica pentru subunitatea de 220 kD. Aceasta subunitate mare este si subiectul reactiilor de fosforilare si defosforilare la nivelul mai multor situsuri. Forma inalt fosforilata, gasita in vivo, atunci cand activitatea de transcriptie este importanta, este considerabil mai activa decat enzima defosforilata din vitro, cel putin in prezenta promotorului regiunii tardive din adenovirus.

            Domeniul carboxi-terminal al subunitatii celei mai mari a ARN polimerazei II de la drojdii, de la Drosophila si de la mamifere contine multiple repetitii in tandem ale hexapeptidului Tyr-Ser-Pro-Thr-Ser-Pro-Ser. Numarul acestor copii este 26 la drojdie la 52 la soarece. Aceasta secventa repetitiva este unica si esentiala pentru activitatea enzimei. Modificarea acestei regiuni in gena de drojdie demonstreaza ca subunitatile care contine mai putin de 13 la 13 copii nu sunt functionale in vivo. Serinele si treoninele, abundente in aceasta regiune, pot fi situsurile de fosforilare mentionate mai sus, dar rolul precis al acestui heptamer nu este deplin elucidat.

Diapozitiv 35. Cea mai mare subunitate a ARN polimerazei II contine o repetitie esentiala carboxi-terminala care este fosforilata in timpul transcriptiei

Figura: Demonstratia experimentala ca domeniul carboxi-terminal (CTD) al ARN polimerazei II este fosforilat in timpul transcriptiei in vivo.

            Glandele salivare ale cromozomilor politeni au fost preparate de la larvele de Drosophila chiar inainte de naparlire. Preparatul a fost tratat cu un anticorp de soarece pentru regiunea CTD fosforilata si cu un anticorp de capra pentru regiunea CTD nefosforilata. Preparatul a fost apoi colorat cu cu un anticorp anti-capra marcat fluorescent cu fluoresceina (verde) si cu un anticorp anti-soarece marcat fluorescent cu rodamina (rosu). Moleculele de polimeraze care prezinta regiuni CTD nefosforilate vor fi colorate in verde iar cele care prezinta regiuni CTD fosforilate in rosu. Hormonul de naparlire ecdizona induce rate inalte ale transcriptiei in regiunile bufante74EF si 75B; de retinut ca in aceaste regiuni sunt prezente numai CTD fosforilate. Regiunile bufante mici transcrise la rate mari sunt vizibile. Situsurile ne-bufante care sunt colorate in rosu (sageata in sus) sau verde (sageata orizontala), ca si siturile colorate atat in rosu si verde, care produc o culoare galbena (sageata in jos).

 

            Din cursul anterior

Factorii de transcriptie

            ARN polimeraza II, ca si celelalte ARN polimeraze necesita o serie de proteine aditionale pentru a forma un complex de transcriptie functional. Multe sunt proteine care se fixeaza pe ADN si recunosc una sau mai multe secvente care, par sa constituie promotorul genei. Anumiti factori de transcriptie reactioneaza prin intermediul interactiilor proteina-proteina sau cu alti factori si sa modifice astfel specificitatea si afinitatea acestora. Prin interactii mutuale sau cu diferite secvente de ADN, diferitii factori de transcriptie formeaza ansamble proteice complexe care regleaza capacitatea ARN polimerazei II de a initia transcriptia. Cea mai mare parte a complexelor reactioneaza pozitiv crescand frecventa initierilor, dar sunt cunoscute si altele care actioneaza negativ fiind deci represori. Exista chiar si factori care stimuleaza transcriptia unei gene dar inhiba pe cea a alteia. Multi dintre acesti factori sunt specifici unui tesut sau unor celule si nu reactioneaza decat in anumite stadii de dezvoltare; acest lucru permite genelor sa fie transcrise diferit in functie de tesut sau de moment (timp). Intr-un anumit sens, ARN polimeraza reprezinta masinaria de transcriptie, iar interactiile factorilor cu semnalele de reglare de pe ADN sau intre ei, determina unde, cand si cu ce viteza va functiona aceasta masinarie.

            Numarul de factori proteici care actionand in trans sunt implicati in sistemele de transcriptie utilizare de ARN polimeraza II este mereu in crestere cu toate ca nu toti au fost foarte bine caracterizati. Rolul unui factor este in functie de tipurile de aranjamente ale secventelor de ADN, elementele cis care constituie regiunea de reglare a unei gene. Complexitatea lor este atat de mare incat anumiti factori se leaga la mai mult de o secventa de ADN si anumite secvente de ADN reprezinta situsuri de fixare pentru mai multe tipuri de factori. In plus, anumite motive organizate in tandem se suprapun (se incaleca) creand adesea situsuri de legatura suplimentare absente in motivele individuale unde favorizeaza fixarea unui factor sau a altuia. Complexitatea acestor interactiuni, cat si numarul mare de detalii ne-explicate, fac, in momentul de fata, imposibila o descriere de ansamblu a acestui domeniu important. In plus, exista inca nomenclaturi diferite si adesea fara raport care au fost folosite pentru a desemna factorii de transcriptie. Acestea sunt, in general, bazate pe originea , tisulara sau celulara, pe o caracteristica a situsului de legare sau rezulta pur si simplu dintr-o alegere a aleatoare a autorului.

 

Diapozitiv 36. Analiza transcriptilor marcati in formare permite cartarea situsului de initiere a transcriptiei

Figura: Cartarea aproximativa a situsului de initiere a transcriptiei prin analiza transcriptilor in formare sintetizati in vivo.

            O sectiune de ADN care este in curs de transcriere este evidentiata in imaginea de sus. Dupa ce celulele sunt marcate pentru timp scurt, producand molecule de ARN in formare, celulele sunt rupte si moleculele de ARN izolate sunt separate pe baza marimii lanturilor estimata prin centrifugare in gradient de densitate. Fractiile de diferite marimi sunt apoi hibridizate cu fragmentele de restrictie prezentate in diagrama de sus (de la A la E). Cei mai scurti ARN marcati vor hibridiza ci fragmentul de restrictie B care contine situsul de initiere; nucleotidul exact la care incepe transcriptia nu poate fi determinat. Succesiv moleculele de ARN mai lungi vor hibridiza cu fragmente din aval fata de situsul de initiere. Cel mai lung ARN hibridizeaza cu fragmentul D care contine si situsul de terminare.

Diapozitiv 37. ARN polimeraza II initiaza transcriptia secventelor ADN corespuntatoare capatului 5¢ al ARNm

Figura: Cartarea precisa a situsului de initiere a unitatii de transcriptie tarzii a adenovirusului prin transcriptie in vitro

            Stanga: Liniile du sus arata situsurile de restrictie ale HindIII (cu negru), XmaIII (albastru) si SmaI (rosu) din regiunea genomului adenovirusului unde a fost localizat situsul de initiere a transcriptiei prin analiza transcriptilor in formare (aproximativ 16 unitati cartate). Fragmentele de restrictie HindIII, XmaIII si SmaI care comtin situsurile de initiere au fost incubate individual cu un extract nuclear preparat din celule HeLa si ribonucleotid trifosfati marcati cu alfa-32P.  Transcriptia fiecarui fragment incepe la situsul de start: cand o molecula de ARN polimeraza II care transcrie un fragment ajunge la capatul taiat, si paraseste matrita (“run-off remplate”).

            Dreapta: Transcriptul rezultat este apoi supus electroforezei in gel si autoradiografiei. Daca sunt cunoscute pozitiile situsurilor de restrictie de pe ADN matrita, lungimea transcriptilor “run-off” (in nucleotide, nt) a fragmentelor produse de SmaI (linia 1). XmaIII (linia 2) si HinIII (linia 3) carteaza precis situsul de start la 16,4 unitati de cartare pe genomul adenovirusului. Secventele acestei regiuni a adenovirusului ADN si a capatului 5’ al ARNm corespunzator si a transcriptilor ARN produsi in vitro sunt prezentati in partea stanga jos. Astfel punctul de start pentru transcriptia in vitro realizata de catre ARN polimeraza II corespunde situsului “cap” al ARNm. Proba din linia 1a este aceeasi cu cea din linia 1, cu exceptia prezentei alfa-amanitinei, ca inhibitor al polimerazei II, care a fost inclus in amestecul de transcriptie. Benzile din partea superioara si inferioara agelului reprezinta moleculele cu mase moleculare ale transcriptilor mari si mici care se formeaza in conditile acestui experiment.

Diapozitiv 38. Concluzii

Principalul scop al controlului genetic in organismele multicelulare este realizarea deciziilor precise de dezvoltare astfel incat gene particulare sunt exprimate in celule particulare in timpul dezvoltarii si diferentierii celulare;

            Controlul transcriptional este principalul sens al reglarii expresiei genice atat la eucariote cat si la procariote;

            In genoamele eucariote, elementele de control care actioneaza in cis si care regleaza expresia de la nivelul promotorului sunt adesea localizate la multe kb departare de situsul de start. In contrast, elementele de control bacterian sunt dispuse, in general, pe o distanta de 60 pb fata de promotorul pe care acestia il regleaza;

            Eucariotele contin trei tipuri de ARN polimeraze nucleare. Toate trei contin doua subunitati mari si doua subunitati mici care constituie structura centrala omologa cu subunitatile b,  b’ si a ale ARN polimerazei de la E. Coli, cat si numeroase subunitati mai mici aditionale. Unele dintre aceste subunitati mici sunt comune iar altele sunt unice pentru fiecare polimeraza;

            ARN polimeraza I sintetizeaza numai pre-ARNr, ARN polimeraza II sintetizeaza ARNm si unele molecule mici de ARN nuclear care participa la splicingul ARNm iar ARN polimeraza III sintetizeaza ARNt, ARNr 5S si multe alte molecule relativ scurte si stabile de ARN.

            O secventa heptapeptidica, domeniul carboxi-terminal (CTD), din subunitatea cea mai mare a ARN polimerazei II este fosforilata in timpul initierii si ramane fosforilata cat timp enzima transcrie matrita;

            Similara cu ARN polimerazele bacteriene, ARN polimeraza II initiaza, de obicei, transcriptia genelor la nivelul unor perechi de baze specifice sau baze vecine alternative din ADN matrita. Nucleotidul din 5’ caruia i se adauga capisonul la nivelul ARNm corespunde nucleotidului de pe catena matrita la care transcriptia este initiata.  

Diapozitiv 39. TATA box este cel mai bine conservat promotor la eucariote

Figura: Comparatii ale secventelor nucleotidice situate in amonte de situsul de start la 60 de gene care codifica pentru  proteine diferite de la vertebrate

            Fiecare secventa a fost aliniata pentru a maximiza omologia regiunii –35 la –20. Numerele introduse in tabel reprezinta frecventa fiecarei baze la fiecare pozitie. Omologie maxima apare pentru o regiune de 6 baze, care se refera la TATA box si a carei secventa este prezentata in partea de jos. Baza initiala cea mai frecventa din ARNm codificat de genele care contin o TATA box este A.

Diapozitiv 40. Identificarea elementelor de control transcriptional cu “linker mutants

Figura: Analize de scanare mutationala care identifica elemedntele de control-transcriptional.

            O regiune de ADN eucariot (galben) care sustine nivele de expresie crescute ale unei gene raportor (albastru deschis) este clonata intr-un vector plasmidial obtinandu-se un numar de clone. Mutatii pozitionate la nivelul regiunii de control in diferite regiuni sunt introduse de la un capat la altul al fragmentului.  Aceste mutatii sunt rezultatul inlaturarii aleatroare a unei scurte secvente din ADN. Plasmidele mutante sunt transfectate separat in celule an cultura si este determinata activitatea genei raportoare. In exemplul ipotetic muattiile LS (linker scaning) 1,4,6, 7 si 9 nu au efect sau au efect slab asupra expresiei genei raportor, indicand ca regiunile afectate in acesti mutanti nu contin elemente de control.  Exprfesia genei raportor este semnificativ afectata pentru mutantii 2, 3, 5, si 8 indicand ca elementele control (in maron) sdunt situate in pozitiile indicate in partea inferioara a figurii.    

Diapozitiv 41. Elementele din proximitatea promotorului pot interveni in reglarea genelor eucariote

Figura: Identificarea elementelor din proximitatea promotorului care controleaza gena timidin-kinazei (tk) sin virusul herpex simplex (HSV) prin analiza LS (linker scaning) a mutatiilor.

            a) O serie de contructii ADN a fost preparata, in fiecare constructie o regiune de aproximativ 10 pb situata in amonte de situsul start al genei tk este mutanta prin inlocuirea cu un linker sintetic care contine un situs de restrictie. Fiecare constructie a fost co-injectata cu o gena tk pseudo-salbateca in ovocitele de Xenopus Laevis in care gena tk a HSV este transcrisa cu o frecventa ridicata. Dupa 24 de ore, a fost izolat ARN si dozat prin metoda de extinctie a primerului folosind un primer ARN marcat (rosu deschis) complementar cu o scurta sectiune a ARNm pentru tk. Gena pseodo-salbateca, care poseda o deletie de 10 pb, serveste drept control intern a activitatii transcriptionale a ovocitelor injectate si a recuperarii ARN.

            b) Produsii de extindere a primerilor au fost analizati prin gel electroforeza si autoradiografie. Dozarea ARN produsa de mutatsii LS (linker scaning) conduce la doua tipuri principale de produsi: unul contine 90 de nucleotide corespuntatoare extensiei tuturor incepand de la capatul 5’ al ARN; cel de al doilea este mult mai mic datorita incompletei extensii. Determinarea ARN transcris de la nivelul genei pseudo-salbatice conduce si ea la doi  produsi: unul lung de 80 de nucleotide si altul mult mai scurt. Benzile marcate ale fiecarui mutant “linker scaning” sunt comparate cu cele ale genei pseudo-salbatice injectate in acelasi ovocit (benzile subtiri de fond sunt ignorate). Mutantii LS sunt numiti prin intervalul din amonte la nivelul caruia secventa salbateca din amonte a tk este mutata. De retinut ca densitatea descrescatoare a benzilor indica descresterea transcriptiei tk, pentru moleculele de ADN LS mutante marcate in rosu.

            c) Pe baza rezultatelor au fost cartate elementele din regiunea proximala promotorului (in maron) genei tk.

Diapozitiv 42. Transcriptia catalizata de ARN polimeraza II este adesea stimulata de secvente “enhancer” departate

Figura: Identificarea regiunii “enhancer” a SV40.

            Au fost construite plasmide continand gena beta-globinei cu sau fara prezenta unui fragment de 366 pb provenind de la SV40. Fiecare plasmida a fost transfectata separat in fibroblaste in cultura, care in mod normal nu exprima beta-globina (etapa 1). Cantitatea de ARNm pentru beta-globina sintetizata de celulele transfectate a fost determinata prin metoda de protectie cu nucleaza S1. Sonda folosita in aceasta determinare a fost un fragment de restrictie, generat din ADNc pentru beta-globina, complementar cu capatul 5’ al ARNm pentru beta-globina (etapa 2). Capatul 5’ al sondei a fost marcat cu 32P (punctele rosii). Cand ARNm pentru beta-globina a fost hibridizat cu sonda, un fragment de aproximativ 340 nucleotide din sonda a fost protejat de digestia cu nucleaza S1 (etapa 3). Autoradiografia fragmentelor protejate de S1 (etapa 4) evidentiaza ca celulele transfectate cu plasmida 1 (linia 1) produc mai mult ARNm pentru beta-globina decat cele transfectate cu plasmida 2 (linia 2). Linia C reprezinta controlul ARNm pentru beta-globina izolat din reticulocite care sintetizeaza activ beta-globina. Aceste rezultate demonstreaza ca fragmentul de ADN pentru SV40 contine un element, numit “enhancer” (activator) care stimuleaza mult sinteza ARNm al beta-globinei.

Diapozitiv 43. Majoritatea genelor eucariote sunt reglate prin mai multe mecanisme de control

Figura: Comportamentul general al elementelor de control care actioneaza in cis pentru reglarea expresiei genelor la drojdii si la orgamismele multicelulare (nevertebrate, vertebrate si plante).

            a) Genele organismelor multicelulare contin atat elementele proximale promotorului si “enhancerii” (activatorii) cat si TATA box sau alte elemente promotoare. Ultimile pozitioneaza ARN polimeraza II pentru a initia transcriptia la situsul de start si influenteaza rata transcriptiei. Activatorii pot fi pozitionati fie in amonte fie in aval si la o distanta de aproximativ 50 kb fata de situsul de start al transcriptiei. In unele cazuri, elementele din proximitatea promotorului apar la fel de bine si in aval de situsul de start al transcriptiei.

            b) majoritatea genelor de drojdii contin numai o regiune reglatoare, numita “secventa activatoare in amonte” (Upstream Activating Sequence-UAS) si o TATA box, care este de aproximativ 90 pb in amonte de situsul de start.

Diapozitiv 44. Concluzii

Expresia genelor eucariote care codifica pentru proteine este reglata prin interventia unor elemente multiple care actioneaza sub forma unor regiuni de control in cis. Unele elemente de control sunt localizate in apropierea situsului de start (elemente din proximitatea promotorului), in timp ce altele sunt localizate la distanta (activatori sau “enhanceri”);

            Promotorii determina situsul de initiere a transcriptiei si legarea directa a ARN polimerazei II. Au fost identificate trei tipuri de secvente promotor pentru ADN de la eucariote. TATA box, tipul cel mai comun este dominant pentru genele transcrise rapid. Promotorii de tip initiator sunt reprezentati cu o frecventa scazuta in anumite gene in timp ce insulele CpG sunt caracteristice genelor transcrise;

            Elementele din proximitatea promotorului sunt localizate intr-un interval de 200 pb fata de situsul de start. Multe astfel de elemente, continand mai putin de 20 pb, pot fi utile in reglarea unei gene particulare;

            Activatorii, care au de obicei o lungime de aproximativ 100-200 pb, contin mai multe elemente control de 8 la 20 pb. Acestea pot fi localizate de la 200 pb la 10 kb in amonte sau in aval de promoter, in interiorul unui intron, sau in aval de exonul final al genei;

            Elementele din proximitatea promotorului si activatorii sunt adesea specifici unui tip celular, functionand numai tipuri celulare diferentiate specific.

Diapozitiv 45. Factoriii implicati in transcriptie sunt identificati prin tehnici biochimice

Ca si la E. coli, diferitele elemente transcriptionalke de control prezente la eucariote sunt situsuri de legare a proteinelor reglatoare care actioneaza in trans. Mai departe o sa discutam despre identificarea, purificarea si structura acestor factori de transcriptie care sunt activatori si represori ai genelor proteice care codifica pentru proteine.

Dupa identificarea elementelor reglatoare cu ajutorul analizelor mutationale descrise anterior, pasul urmator il reprezinta identificarea proteinelor care recunosc aceste structuri si se leaga specific la ele.

            Figura evidentiaza modul in care un extract proteic nuclear este supus mai multor etape cromatografice si apoi unor analize de “footprinting” cu DN-aza I  sau de “intarziere in gel” folosint fragmente de ADN care contin elementele reglatoare in cis deja identificate. Fractiile care contin proteine care se leaga la elementele reglatoare este foarte probabil sa contina un posibil “putativ” factor de transcriptie. O tehnica buna pentru etapa de purificare finala a factorilor de transcrptie o constituie un tip particular de cromatografie de afinitate specifica unei secvente de ADN. Ca un test final, capacitatea proteinelor izolate de a stimula transcriptia unei matrici care contine un situs corespunzator de legare a proteinei,  se realizeaza o reactie de transcriptie in vitro.

O data ce factorul de transcriptie a fost izolat, secventa sa partiala in aminoacizi poate fi determinata si folosita pentru pentru clonarea genei sau a ADNc codificat de aceasta. Gena izolata poate fi folosita apoi pentru a testa capacitatea proteinei codificate de a stimula transcriptia intr-o reactie de transcriptie in vitro. 

            Figura: Purificarea factorilor de transcriptie

a)      Mai multe etape cromatografice sunt folosite pentru purificarea unui factor de transcriptie (proteina inrudita, asemanatoare, similara) care se leaga specific la un element reglator din structura ADN. Purificarea finala este obtinuta prin cromatografie de afinitate pe o coloana care este cuplata cu cu catene lungi de ADN care contin mai multe copii al situsului de legare a factorului proteic. Un preparat proteic partial-purificat care contine factorul de transcriptie este aplicat pe o coloana cu o tarie ionica scazuta (100 mM KCl). Proteinele care nu se leaga deloc la situsurile specifice vor fi eluate cu tampoane cu salinitate scazuta. Proteinele cu afinitate scazuta pentru situsul de legare sunt spalate de pe coloana cu toampoane de salinitate intermediara (300 mM KCl). In final, factorii proteici inalt purificati sunt eluati cu solutii saline concentrate (1 M KCl);

b)       Proteinele separate prin cromatografie pe coloana sunt testate pentru capacitatea lor de legare la un element reglator identificat. In acest exemplu, testarile ADN “footprinting”pentru proteinele separate prin cromatografie de schimb ionic indica ca fractiile de interes sunt 9-12. Aceste proteine pot fi testate si prin tehnica de intarziere in gel.

 

Diapozitiv 46. Determinarea “in vitro” a activitatii factorilor
de transcriptie

Figura: testarea in vitro a activitatii de transcriptie

Sistemul experimental folosit necesita prezenta a doua plasmide. O plaamida contine gena care codifica pentru un factor posibil (putativ) de transcriptie-proteina X. Cea de a doua plasmismida contine o gena raportor si unul sau mai multe situsuri de legare a proteinei X. Ambele plasmide sunt simultan introduse in celule gazda carora le lipsesc gena care codifica pentru proteina X si gena raportor. Este masurata transcriptia ARN produsa de gena raportor; alternativ, activitatea proteinelor codificate poate fi determinata. Daca transcriptia genei raportor este mai mare in prezenta plasmidei care codifica proteina X, inseamna ca proteina este un activator; daca transcriptia este mai scazuta, atunci este un represor. Prin folosirea unor plasmide care codifica au factor de transcriptie mutant sau care contine o rearanjare, pot fi identificate domeniile importante ale proteinei.  

Diapozitiv 47. Ex: serii de mutanti Gal4 purtatori de deletii-demonstreaza ca factorii de transcriptie sunt compusi din domenii separate de legare si de activare

Identificarea genetica a genelor care codifica pentru factori de trancscriptie

La drojdii, genele care codifica pentru factori de transcriptie au fost mai intai identificate prin analize genetice clasice. De ex, una dintre genele de la drojdii necesare cresterii este numita Gal4. Incubarea unor celule salbatice intr-un mediu care contine galactoza are drept rezultat cresterea de aproximativ o mie de ori a cantitatii de ARNm pentru enzimele implicate in metabolismul galactozei. Aceasta activare nu se poate observa in cazul mutantilor gal4. Studii de mutageneza dirijata asemanatoare celor prezentate anterior pentru determinarea regiunilor UAS pentru genele inductibile. S-a determinat ca fiecarfe regiune UAS contine mai mult de o copie a secventei de 17 pb inrudite numita UASGAL. Cand o copie a UASGAL a fost clonata in amonte de o secventa TATA box urmata de o gena raportor lacZ, expresia lacZ a fost activata in celulele salbatice cultivate pe mediu cu galactoza, dar nu si in cazul mutantelor gal4. Aceasta indica ca UASGala este un element de control al transcriptiei activat de catre proteina Gal4 pe mediile cu galactoza.

Gena Gal4 a fost izolata prin complementare mutantului gal4 cu o banca de ADN de drojdii salbatec. Prin folosirea tehnicilor de recombinare a ADN, proteina Gal4 a fost exprimata in E. Coli si s-a determinat legarea acesteia la UASGAL  . Cand proteina Gal4 se leaga la secventele UASGAL si activeaza transcriptia din apropierea promotorului cand celulele sunt plasate pe mediu cu galactoza.

Studii genetice clasice au fost realizate si pe multe alte organisme cum sunt Drosophila, C. Elegans si plantele superioare au dus la descoperirea mai multor gene care codifica pentru factori de transcriptie.

Activatorii transcriptionali sunt proteine modulare compuse din domenii functionale distincte

Un remarcabil set de experimente realizate cu proteina Gal4 de la drojdii au demonstrat ca acest factor de transcriptie este compus din domenii functionale separabile: un domeniu de legarea a ADN care interactioneaza cu secvente specifice de ADN si un domeniu de activare, care interactioneaza cu alte proteine pentru a stimula transcriptia de la nivelul secventelor din apropierea promotorului. In aceste experimente o serie de mutanti de deletie gal4 au fost testati pentru capacitatea lor de a activa transcriptia unei gene raportor (lacZ) legata la UASGAL. Masurarea activarii transcriptiei a fost masurata in celulele care gena GAL4 si deci si proteina gal4 nu vor interfera cu analiza. Legarea proteinei mutante Gal4 la secventa UASGAL poate fi si aceasta testata. Rezultatele acestor experimente, evidentiate in figura demonstreaza ca Gal4 contine un un domeniu N-terminal de legare la ADN de 74 aminoacizi si un domeniu activator C-terminal. Cand domeniul N-terminal de legare la ADN a fost fuzionat cu difrerite fragmente C-terminale, proteinele trunchiate rezultate pastreaza capacitatea de a stimula expresia genei raportor. Deci regiunea interna a proteinei nu este necesara pentru functionarea Gal4 ca factor de transcriptie.

Experimente similare au fost realizate si pentru factorul de transcriptie de la drojdii Gcn4, care regleaza genele necesare pentru sinteza multor aminoacizi, indica existenta unui domeniu de legare de aproximativ 60 aa si un domeniu de activare C-terminal de aproximativ 20 aa pozitionat in apropierea mijlocului secventei.  

Studii de acest fel au fost realizate pentru multi factori de transcriptie de la drojdii. Domeniile de activare ale factorilor de transcriptie de la mamifere au fost adesea determinate frecvent prin fuzionarea lor cu domeniul de legarea al Gal4 cand celuzlele de mamifere nu contin un factor endogen capabil sa se lege la secventa UASGAL. Modelul structural a activatorilor de la eucariote care a fost emanat din aceste studii este unul modular in care unul sau mai multe domenii activatoare sunt conectate unui domeniu de legare capab il sa recunoasca secvente specifice de legare la ADN. In unele cazuri, aminoacizii inclusi in domeniul de legare contribuie si el la activarea transcriptionala. Asa cum s-a discutat anterior, domeniile de activare se crede ca functioneaza prin intermediul interactiilor proteina-proteina cu factorii de transcriptie legati la promotor. Domeniile proteice ale activatorilor, care conecteaza domeniile de legare la ADN cu domeniile de activare pot explica de ce modificarile in spatiul dintre elementele de control sunt atat de bine tolerate la nivelul regiunilor de control de la eucariote. Cand domeniile de legare din apropierea factorilor de transcriptie sunt deplasate de pe pozitiile lor relative de pe ADN, domeniile lor de activare pot inca sa interactioneze deoarece atasarea lor la domeniile de legare este flexibila.

Figura: Demonstratie experimentala care demonstreaza existenta

Diapozitiv 48. Activatorii transcriptionali sunt proteine modulare compuse din domenii functionale distincte

Figura: Diagrame schematice care ilustreaza structura modulara a activatorilor de transcriptie de la eucariote

Acesti factori de transcriptie pot contine mai mult de un domeniu de activare dar arareori contin mai mult de un domeniu de legare la ADN. Receptorul glucocorticoid (GR), care contine si un domeniu de legare a hormonului (nu se vede) activeaza transcriptia genelor tinta in prezenta anumitor hormoni. Sp1 se leaga la regiunea promotoare bogata in elemente GC intr-un numar mare de gene de mamifere. Domeniile proteice cu flexibilitate mare din structura activatorilor sunt extrem de sensibile la digestia cu proteaze.

Din cursul anterior

Factorii de transcriptie se leaga la ADN si activeaza transcriptia prin intermediul domeniilor independente

 

            Factorii de transcriptie si alte proteine reglatoare sunt necesari pentru doua tipuri de activitati:

            - Ei trebuie sa recunoasca secventele tinta specifice localizate in activatori, promotori, sau alte elemente reglatoare care afecteaza o anumita gena. (Pentru o proteina represor, legarea la ADN poate fi suficienta pentru a-si exercita functia: prezenta proteinei serveste pentru a impiedica expresia genei).

            - Pentru un factor se transcriptie sau o proteina reglatoare este necesar mai mult; odata legata la ADN, proteina isi exercita functia prin legarea altor componente care fac parte din aparatul de transcriptie.

            Putem caracteriza domeniile factorilor de transcriptie care sunt responsabili pentru aceste activitati ? Adesea domeniile care leaga ADN si activeaza transcriptia sunt separate, si fiecare functioneaza independent. De fapt, putem vedea (considera) functia domeniului de legare a ADN ca fiind completa odata ce domeniul de activare a fost adus in vecinatatea punctului de start. Acest model pentru factorul de transcriptie este prezentat in figura 30.2 (Genes V). In principiu, este necesar ca conexiunea dintre domeniile de legarea a ADN si cel de activare sa fie destul de flexibila pentru a permite domeniului de activare sa gaseasca tintele sale proteice fara a tine seama de situsul exact continut de domeniul de legare a ADN la nivelul promotorului. Proteina tinta este cel mai probabil un factor de transcriptie bazal. Experimentele cu diferite sisteme sugereaza ca principiul domeniilor independente este comun pentru activatorii transcriptiei.

            Natura modulara a activatorilor transcriptiei a fost bine caracterizata pentru activatorul GAL4 de la drojdie, care controleaza transcriptia genelor ai caror produsi sunt responsabili de metabolizarea galactozei. Reglarea se realizeaza la UASG (o secventa de activare din amonte care la drojdii este echivalentul unui activator). Proteina GAL4 are 4 situsuri de legare in UASG. Fiecare situs este o copie a palindromului care are o secventa consens de 17 pb. Totusi, o singura copie a secventei consens este adecvata pentru a conferi susceptibilitate (sensibilitate) la reglarea GAL4.

            Proteina GAL4 are trei functii: ea se leaga la ADN; ea activeaza transcriptia; si ea leaga o alta proteina reglatoare, numita GAL80. Aceste functii pot fi separate, cum este descris in figura 30.3 (Genes V).

            Domeniul de legare a GAL4 consta in 65 de aminoacizi terminali. Fragmentul N-terminal poate lega secventa consens obisnuita, dar nu activeaza transcriptia.

            Capacitatea de a activa transcriptia poate fi conferita de catre doua alte regiuni ale proteinelor: fie secventa 148-196 fie 768-881, daca atasarea la domeniul de legare a ADN poate activa transcriptia.

            Regiunea 65-94 permite proteinei sa formeze dimeri (dimerizeze). Este destul de normal pentru factorii de transcriptie sa posede domenii adiacente pentru legarea ADN si dimerizare.

            Regiunea 851-881, localizata in interiorul unuia dintre domeniile dezactivare, leaga GAL80. DE fapt, aceasta este modalitatea prin care GAL4 raspunde la galactoza. Expresia genelor GAL este indusa de catre galactoza, care se leaga la proteina GAL80. In absenta galactozei, proteina GAL80 leaga GAL4 si o impiedica sa realizeze activarea transcriptiei. Galactoza induce transcriptia prin eliberarea GAL80, permitand astfel GAL4 sa functioneze efectiv. Aceasta este una dintre variantele unei teme comune: o proteina (sau oricare alt ligand) se leaga la un factor de transcriptie pentru a regla (direct sau indirect) domeniul sau activare a transcriptiei.

            Este natural ca legarea la ADN este prealabila activarii transcriptiei. Depinde activarea de un anumit domeniu de legare la ADN (DNA-binding domaine).

            In figura 30.4 este ilustrat un experiment pentru a raspunde la aceasta intrebare. Represorul bacterian LexA are un capat N-terminal al domeniului de legare la ADN care recunoaste un operator specific; legarea LexA la acest operator reprima promotorul adiacent. Intr-un experiment ‘de schimbare’, aceasta secventa poate fi inlocuita cu domeniul de legare al GAL4. Gena hibrid poate fi introdusa in drojdii impreuna cu gena tinta care contine fie operatorul US fie LexA.

            O proteina GAL4 autentica poate activa o gena tinta numai daca are un operator UAS. Represorul LexA singur nu are capacitatea de a activa nici un fel de tinta. Hibridul LexA-GAL4 nu mai poate nici el sa activeze o gena cu un UAS, dar acum poate activa o gena care are un operator LexA.

            Acest rezultat corespunde punctului de vedere modular asupra activatorilor transcriptiei sugerat in figura 30.2. Domeniul de legare a ADN serveste in aducerea proteinei intr-o localizare corecta. Cum si unde acesta se leaga la ADN nu este relevant, dar, odata legate, domeniile de activare a transcriptiei pot determina initierea transcriptiei. In acord cu acest punct de vedere, nu mai are importanta atat de mare daca domeniile de activare a transcriptiei sunt aduse in vecinatatea promotorului prin recunoasterea UAS via domeniului de legare a GAL4 sau prin recunoasterea operatorului LexA via specificitatii modului LexA. Capacitatea celor doua tipuri de module de a functiona in proteine hibride sugereaza ca fiecare domeniu al proteinei se pliaza independent intr-o structura activa si nu este influentata de restul proteinei.

            Ideea ca factorii de transcriptie au domenii independente care leaga ADN si care activeaza transcriptia este intarita de capacitatea proteinei tat a virusului HIV de a stimula initierea fara a se lega deloc la ADN. Proteina tat se leaga la o regiune a structurii secundare a produsului ARN; partea ARN necesara pentru actiunea tat este numita secventa tar. Un model al rolului interactiei tat-tar in stimularea transcriptiei este dat in figura 30.5.

            Secventa tar este localizata chiar in aval de punctul de start, astfel incat cand tat se leaga la tar, este adusa in vecinatatea complexului de initiere. Acest lucru este suficient pentru a asigura ca domeniul sau de activare sa fie destul de aproape de complexul de initiere. Domeniul de activare interactioneaza cu unul sau mai multi factori de transcriptie legati la complex in acelasi fel ca si un factor de transcriptie situat in amont. (De retinut ca cel putin primul transcript trebuie sa fie inceput in absenta tat pentru a furniza astfel situsul de legare).

            O demonstratie extrema privind independenta localizarii si activarii domeniilor a fost data de cateva constructii in care tat integrat astfel incat domeniul de activare a fost conectat la domeniul de legare a ADN in locul secventei obisnuite de legare tar: cand un situs tinta adecvat este plasat in promotor, domeniul de activare tat poate activa transcriptia. Aceasta sugereaza ca putem considera domeniul de legare al ADN (sau in acest caz domeniul de legare al ARN) ca furnizand o functie ‘de fixare’ (de priponire), al carei scop principal este sa se asigure ca domeniul de activare se afla in vecinatatea complexului de initiere.

            Notiunea de priponire este un exemplu mult mai specific pentru ideea generala ca initierea necesita o concentratie mare de factori de transcriptie in vecinatatea promotorului. Acest deziderat poate fi atins cand factorii se leaga de activator care se afla la o anumita distanta pe ADN linear, cand factorii se leaga in amont de componentele promotorului, sau in caz extrem prin priponirea (fixarea) unui produs ARN. Cerinta comuna a tuturor acestor situatii este flexibilitatea exact cele in trei dimensiuni a aranjamentului format din ADN si proteine.

            Exista diferite modalitati prin care factorii de transcriptie situati in amont activeaza transcriptia, dar cea mai obisnuita modalitate este probabil interactia proteina-proteina cu un factor de transcriptie bazal. Cele mai comune tinte pentru activare par sa fie TFIIID si TFIIIB.

            Domeniile de activare ale factorilor de transcriptie GAL4 si GCN4 de la drojdie au multe sarcini negative, de unde descrierea lor drept ‘activatori acizi’. Un alt activator efectiv particular de acest tip este proteina VP16 a virusului Hepex Simplex (VP16 nu are un domeniu de legare la ADN, dar interactioneaza cu aparatul de transcriptie via o proteina intermediara =. Experimentele realizate pentru a putea caracteriza functionarea activatorului acid au fost realizate adesea folosind regiunea de activare a VP16 legata la cateva motive de legare a ADN.

            Nu este clar daca sarcinile negative sunt necesare pentru functionarea ‘activatorilor acizi’. Pe de o parte, secventele care au capacitate activatoare cand se leaga la domeniul de legare a ADN al GAL4 pot exista sub forma unei serii de secvente polipeptidice scurte care au in comun numai faptul ca poseda sarcini negative. Aceasta sugereaza ca regiunea de activare este reprezentata de ‘un lob acid’ (regiune acida) care interactioneaza intr-o maniera relativ nespecifica cu alte proteine implicate in transcriptie. Se considera ca mutatiile care determina indepartarea (pierderea) aminoacizilor acizi reduc abilitatea de activare, in timp ce mutatiile care indeparteaza aminoacizii bazici genereaza activatori mult mai eficienti. Totusi, mutarea sistematica pentru a indeparta gruparile incarcate din GAL4 nu afecteaza asupra capacitatii de activare. Probabil este importanta lipsa sarcinilor pozitive. Domeniile de activare ale GAL4 si GCN4 formeaza foi b (b-sheets, pliere b) care furnizeaza probabil o interfata pentru contactarea altor proteine.

            Activatorii acizi functioneaza prin schimbarea capacitatii TFIIB sa lege complexul bazal de initiere. Experimentele in vitro arata ca legarea TFIIB la complexul de initiere pentru un promotor al adenovirusului este stimulata de prezenta activatorilor acizi GAL4 sau VP16; VP16 se poate lega direct la TFIIB. Asamblarea TFIIB in complex pentru acest promotor (al adenovirusului) reprezinta o etapa limitanta de viteza care este stimulata de prezenta unui activator acid.

            Alte tipuri de motive de activare sunt mult mai putin bine caracterizate, dar includ o regiune bogata in glutamina pentru Sp1 si o regiune bogata in prolina in CTF. Sp1 pare sa necesite proteinele TAF (TAFs= TBP asociated factors) care sunt asociate cu TBP (TATA binding protein) pentru aceasta actiune, astfel incat tinta sa de activare sa fie complexul TFIID. Exista date care indica ca activatorii pot actiona cu TFIID.

            Elasticitatea promotorului ARN polimerazei II fata de rearanjarea elementelor, si chiar prezenta unor elemente particulare, sugereaza ca evenimentele (etapele, procesele) prin care acesta este activat sunt intr-o oarecare masura independente context si relativ generale (destul de generale). De fapt, orice factor situat in amont si a carui regiune de activare este adusa in aceeasi orientare (la acelasi nivel) cu complexul bazal de initiere poate fi capabil sa stimuleze formarea acestuia. Cateva din dovezile izbitoare ale acestei vesatilitati (multiplicitatii/elesticitatii) au fost furnizate prin construirea unor promotori care constau in noi combinatii de elemente. De exemplu, cand elementul UASG de la drojdie este inserat langa promotorul unei gene de la un eucariot mai evoluat, aceasta gena poate fi activata de GAL4 in culturi celulare de mamifere.

            Deoarece GAL4 activeaza promotorul se pare ca aceasta proteina este bine conservata evolutiv incepand de la drojdii si pana la eucariotele superioare. Proteina GAL4 trebuie sa recunoasca anumite trasaturi ale aparatului de transcriptie de la mamifere care se aseamana cu punctele sale normale de contact de la drojdie. O interpretare este aceea ca de fapt exista componente comune, fie ale ARN polimerazei fie ale altor factori de transcriptie, care pot fi recunoscuti de catre unul sau mai multi factori pentru a activa transcriptia. Componentul comun poate fi mai degraba un motiv dintr-o proteina decat o proteina intreaga.

Diapozitiv 49. Domeniile de legare la ADN pot fi clasificate in mai multe tipuri structurale

Ø      Proteine care contin homeodomenii

Ø      Proteine “Zinc-finger

Ø      Proteine “Winged-helix (forkhead)

Ø      Proteined “Leucine-zipper

Ø      Proteine “Helix-loop-helix

Factorii de transcriptie de la eucariote contin o varietate de motive structurale care interactioneaza cu secvente de ADN specifice. Ca si la majoritatea activatorilor si represorilor bacterieni , elicele alfa ale factorilor de transcriptie de la eucariote sunt orientate astfel incat sa faca posibila legarea la fosa majora a ADN unde atomii din structura proteinelor participa la formarea legaturilor de hodrogen si a legaturilor Van der Waals cu atomi din structura ADN. Interactiile cu atomii scheletului fosfat, si in unele cazuri cu atomii din structura ADN de la nivelul fosei minore contribuie si acestea la legare.

Analizele cristalografice cu raze X ale complexelor dintre situsuri de legare specifice din structura ADN si factori de transcriptie izolati au evidentiat un numar de motive structurale care pot prezenta un alfa-helix in fosa majora.   

Din cursul anterior

Exista multe tipuri de domenii de legare a ADN (ADN binding domains)

            Comparatiile intre secventele mai multor factori transcriptionali (implicati in transcriptie) sugereaza ca pot fi regasite tipuri comune de motive care sunt responsabile pentru legarea ADN (pentru legarea la ADN). Motivele sunt intotdeauna destul de scurte si cuprind numai o mica parte a structurii proteinei. Motivele au fost de asemenea identificate ca fiind responsabile de activarea transcriptiei via interactiilor dintre proteinele aparatului de transcriptie. Exista informatii detaliate despre numeroase grupuri de proteine care regleaza transcriptia folosind motive particulare (anumite tipuri de motive) pentru a lega ADN:

            - Receptorii steroizi sunt definiti ca grup printr-o relatie functionala: fiecare receptor este activat prin legarea unui anumit steroid (un steroid particular). Receptorul pentru glucocorticoid este cel mai studiat.  Impreuna cu alti receptori, cum sunt receptorul pentru hormonul tiroidian sau receptorul pentru acid retinoic, receptorii steroizi sunt membrii unei superfamilii de factori de transcriptie cu acelasi mod general de operare (modus operandi).

            - Motivele degete cu zinc (zinc finger) cuprind un domeniu de legare a ADN (care leaga ADN). Au fost original recunoscute in factorul TFIIA, care este necesar ARN polimerazei III pentru a transcrie genele care codifica ARNr 5S. De atunci au fost identificate in numerosi alti factori de transcriptie (si presupusi factori de transcriptie). O forma distincta a motivului a fost gasita si in receptorii steroizi.

            Motivul “Winged-helix” (inaripat) sau “Forkhead” (ramificat) este caracteristic domeniilor de legare la ADN ale histonei 5 si a altor factori de transcriptie care au fost evidentiati ca fiind implicati in functionarea timpurie la Drosophila si mamifere. Asemeni proteinelor “zinc-finger” C2H2, proteinele “winged-helix” se leaga in genmeral la ADN ca monomeri.  

            Motivul helix-turn-helix (helix-cotitura-helix) a fost original identificat ca un domeniu de legare a ADN al fagilor represori. Un a-helix se leaga in fosa mare a ADN; celalalt helix se leaga transversal (de-a curmezisul) peste ADN. O forma inrudita a motivului este prezenta in domeniul homeo (homeo domain), secventa care a fost pentru prima data caracterizata la numeroase proteine codificate de gene implicate in reglarea dezvoltarii la Drosophila. Aceste domenii au fost identificate acum in gene care codifica pentru factorii de transcriptie de la mamifere.

            - Motivul amfipatic helix-loop-helix (helix-bucla-helix) (HLH) a fost identificat in cazul catorva regulatori de dezvoltare si in genele care codifica pentru proteine care leaga ADN. Fiecare helix amfipatic prezinta o faza formata din resturi hidrofobe si cealalta formata din resturi incarcate (sarcini). Lungimea buclei (loop) de conectare variaza de la 12 la 28 de aminoacizi. Motivul permite moleculelor sa dimerizeze, si o regiune bazica (incarcata pozitiv) situata langa acest motiv intra in contact cu ADN.

            - Motivul fermoar de leucine sau agrafe cu leucina (leucine zippers) consta intr-o regiune (intindere) formata din aminoacizi in care fiecare al saptelea aminoacid este o leucina. O secventa leucine zipper (fermoar leucina) de pe o polipeptida interactioneaza cu o alta secventa de acelasi tip de pe o alta polipeptida pentru a forma un dimer. Adiacent (in apropierea) fiecarui fermoar (zipper) exista o portiune (intindere) de resturi incarcate pozitiv care este implicata in legarea ADN.

            Activitatea unui factor de transcriptie inductibil poate fi reglata in mai multe moduri, asa cum este ilustrat schematic in figura 30.6 (Genes V):

            a) un factor este specific de tesut (tesut specific) deoarece el este sintetizat numai intr-un anumit tip de celula. Mai multi factori de acest tip sunt cunoscuti, multi dintre ei incluzand domenii homeobox.

            b) activitatea unui factor poate fi direct controlata prin modificarea acestuia. HSTF este transformat in forma activa prin fosforilare. AP1 (un heterodimer constituit din subunitatile Jun si Fos) este transformat in forma activa prin defosforilarea subunitatii Jun.

            c) un factor este activat sau inactivat prin cuplarea unui ligand. Receptorii steroidieni sunt primele exemple. Cuplarea (atasarea) ligandului poate influenta atat localizarea proteinei (afectand transportul din citoplasma in nucleu) cat si direct abilitatea (capacitatea) sa de a se lega la ADN.

            d) disponibilitatea unui factor poate varia; de exemplu, factorul NFkB (care activeaza genele k ale imunoglobulinelor in limfocitele B) este prezent in multe tipuri de celule. Acesta poate fi insa retinut in citoplasma de catre inhibitorul proteic I-kB. In limfocitele B, NFkB este eliberat de I-kB si se deplaseaza in nucleu, unde activeaza transcriptia.

            e) un factor cu structura dimera poate avea comportamente diferite. Exista posibilitatea ca un partener sa il inactiveze; sinteza partenerului activ poate deplasa partenerul inactiv. Vom putea vedea mai departe ca astfel de situatii pot fi amplificate in retelele in interiorul carora diferiti parteneri se imperecheaza alternativ unul cu altul. Situatie este valabila mai ales in cazul proteinelor HLH (helix-loop-helix)

Totusi, trebuie sa retinem ca mutatii la nivelul factorilor de transcriptie din unele din aceste clase (categorii) da nastere unor activati ne-adecvat (incorect) sau inhiba activarea transcriptiei; ei pot avea lor in generarea tumorilor. .

            In continuare vor fi discutate mai detaliat reactiile de legare a ADN si de activare, realizate de unele dintre aceste clase de proteine. In multe cazuri, legarea ADN este realizata de o scurta regiune de a-helix care face contact fie cu bazele fie cu scheletul fosfat de la nivelul fosei majore.

Diapozitiv 50. Homeodomeniile  proteinei “engrailed” care interactioneaza cu domeniile specifice din structura ADN

Figura: Homeodomeniul proteinei “engrailed” care interactioneaza specific cu situsul sau specific ADN

Factorul de transcriptie “engrailed” este exprimat in timpul embriogenezei de la Drosophila. Perechile de baze ale situsului de recunoastere care intra in contact direct cu proteina sunt evidentiate in alb. Regiunile mai deschise din proteina contin resturile care intra in contact cu fosa mare.

Din cursul anterior

Domeniile Homeo se pot lega la secvente tinta inrudite de pe ADN

 

‘Homeobox’ este o secventa care codifica pentru un domeniu de 60 aminoacizi

prezenta in proteinele multor sau chiar a tuturor eucariotelor. Numele sau deriva de la identificarea initiala la Drosophila a ‘locilor homeotici’ (acele gene care determina identitatea structurilor corpului). ‘Homeobox’ este prezenta in multe gene care regleaza dezvoltarea timpurie la Drosophila, un motiv inrudit fiind determinat in genele unui mare numar de eucariote superioare. Este foarte atractiva ipoteza ca ‘domeniile homeo’ identifica (sau macar sunt comune acestora) genele implicate in reglarea dezvoltarii. Secvente inrudite cu ‘domeniul homeo’ au fost gasite in multe tipuri de factori de transcriptie de la animale. Extinderea de la ‘domeniile homeo’ originale de la Drosophila la mamifere, corelatiile (relatiile) dintre regiunile conservate scad semnificativ.

            La Drosophila genele homeo, adesea ‘domeniul homeo’ (dar nu intotdeauna) sunt localizate in apropierea capatului C-terminal. cateva exemple de gene care contin regiuni ‘homeo’ sunt prezentate in Figura 30.13 (Genes V). Adesea genele poseda o secventa mica conservata situata in afara ‘homeobox’. Conservarea secventelor ‘homeobox’ variaza. Un grup major de ‘homeobox’ care contine si genele de la Drosophila are o secventa bine conservata, cu 80-90% omologie (asemanare) intre perechile de secvente comparate. Adesea, in factorii de transcriptie animali ‘domeniul homeo’ este combinat cu alte motive. Un exemplu este prezentat de catre proteinele Oct (octamer-binding), care reprezinta un grup in care regiunea de 75 aminoacizi conservata este denumita regiunea Pou si este localizata in imediata vecinatate a unei regiuni care se aseamana cu ‘domeniul homeo’. Secventele corespunzatoare  prezente in ‘domeniile homeo’ ale proteinelor din grupul Pou sunt cele mai indepartate rude ale grupului original, constituind astfel cea mai cea mai indepartata ramura a familiei (cea mai indepartata extensie a familiei).

            ‘Domeniul homeo’ este responsabil pentru legarea la ADN, experimentele de schimbare a ‘domeniilor homeo’ intre proteine sugereaza ca specificitatea recunoasterii ADN este ‘inscrisa’ in interiorul ‘homeo domeniului’. dar (ca si in cazul fagilor represori) nu poate fi dedus un cod simplu care leaga proteina si secventele de ADN. Regiunea C-terminala a ‘domeniului homeo’ arata o omologie cu motivul ‘helix-turn-helix’ al represorilor de la procariote. Asa cum ne amintim represorul lambda poseda un ‘helix de recunoastere’ (a-helix-3) care intra in contact cu fosa majora a ADN, in timp ce celalalt helix (a-helix-2) se leaga intr-un anumit unghi transversal (de-a curmezisul) de-a lungul ADN. ‘Domeniul homeo’ poate fi organizat in trei regiuni sub forma de helix potentiale; in figura 30.14 sunt comparate trei exemple. Partea cea mai bine conservata a secventei se leaga de cel de al treilea helix. Diferentele dintre aceste structuri si structurile represorului de la procariote sunt legate de lungimea helixului care recunoaste ADN, helixul 3, care este cu 17 aminoacizi mai lung in ‘domeniul homeo’, fata de o lungime de 9 resturi in cazul represorului lambda.

            Structura cristalina a ‘domeniului homeo’ al produsului genei D. melanogaster  engrailed (pictata) este prezentata schematic in figura 30.15 (Genes V). Helixul 3 se leaga la nivelul fosei mari a ADN si realizeaza majoritatea contactelor dintre proteina si acidul nucleic. Majoritatea contactelor care orienteaza helixul in fosa majora sunt realizate cu coloana fosfat, deci ele nu sunt specifice pentru secventa ADN. Aceasta se leaga larg pe fata dublului helix, si flancheaza bazele cu care au fost realizate contacte specifice. Celelalte puncte de contact ramase sunt realizate de bratul N-terminal al ‘domeniului homeo’, secventa care precede exact primul helix. Ea este proiectata (orientata/azvarlita) in fosa minora. Astfel, regiunile N- si C-terminale ale ‘domeniului homeo’ sunt primele raspunzatoare de contactul cu ADN (de intrarea in contact cu ADN).

            O interesanta demonstratie a caracterului general al acestui model deriva din compararea structurii cristaline a ‘domeniului homeo’ de la D. melanogaster  engrailed cu proteina a2 de ‘mating’ de la drojdie. Domeniul de legare al acestei proteine se aseamana cu ‘domeniul homeo’, si poate forma trei helixuri similare: structura sa in fosa ADN poate fi suprapusa aproape exact cu cea a ‘domeniului homeo’ de la ‘engrailed’. Aceste asemanari sugereaza ca toate domeniile homeo se leaga la ADN (leaga ADN) in acelasi mod. Aceasta inseamna ca un numar relativ mic de resturi din helixul 3 si din bratul N-terminal sunt responsabile de specificitatea contactelor.

Diapozitiv51. *Interactia ADN-Proteine Modelul ”helix-turn-helix” (HTH)

Figura: Modelul “helix-turn-helix” (HTH) este o structura comuna de recunoastere a ADN si la procariote. In figura avem o imagine obtinuta prin difractie cu raze X pentru dimerul cAMP-CAP care formeaza un complex cu aproximativ 30 pb de duplex ADN.

a)      Complexul vazut cu cele doua plieri fata de axa orizontala in planul hartiei. Proteina este reprezentata prin structurile sale alfa cu domeniul N-terminal de legare a cAMP, colorat in albastru si cel C-terminal de legare la ADN in mov/rosu;

b)       Legarea dimerului CAP prin intermediul motivelor  HTH in fosele mojore succesive ale ADN. Capatul N-terminal al motivului  HTH  este albastru in timp ce helixul de recunoastere este rosu.

Diapozitive 52. *Interactia ADN-ProteineModelul HTH (represorul 434 al bacteriofagullui P22)

Figura: Structura obtinuta cu raze X a represorului 434 al fagului P22 (este evidentiat numai domeniul capatului de 69 de resturi amino-terminal) in complex cu un fragment tinta de 20 pb cu structura d(TATACAAGAAAGTTTGTACT)

a)      Modelul sub forma de scheletcu ADN in stanga si cu cele doua subunitati identice ale proteinei (doua elice alfa) in stanga.

b)       Reprezentare schematica a motivului “helix-turn-helix”, care evidentiaza interactia elicelor alfa2 si alfa3 cu ADN tinta. Barele scurte din structura sunt gruparile peptidice NH, legaturile de hidrogen sunt reprezentate de linii punctate, gruparile fosfat ale ADN prin numere incercuite. Cercurile mici sunt molecule de apa.




c)      Modelul cu bile corespunzator repsrezentarii din figura a. Proteina este reprezentata in galben.

 

Diapozitive 53. Interactia ADN-Proteine Modelul HTH (represorul TRp de la E. Coli)

Figura: Structura cu raze X a complexului represor-operator pentru operonul trp de la E. Coli.

Cele doua subunitati identice ale proteinei sunt reprezentate sub forma de panglici una verde si cealalta mov. Ambele formeaza motivul HTH (elicele D si E). Represorul trp se leaga la operator numai cind L-triptofanul (in rosu) este legat simultan

Diapozitive 54. Interactiile domeniilor C2H2 si C4 zinc-finger cu ADN

Figura:

a)      O proteina C2H2 cu cinci degete numita GL1. Aceasta proteina monomera este codificata de o gena care este amplificata intr-un numar de tumori umane. Regiunile helicale sunt reprezentate prin cilindri iar catenele beta prin panglici. Degetul 1 nu interactioneaza cu ADN, in timp ce celelalte patru degete da. Cercurule negre indica ionii de Zn2+;

b)       regiunile sub forma de helix sunt reprezentate ca spirale  iar catenele beta sub forma de sageti. Doua elice alfa, una din fiecare monomer, interactioneaza cu ADN. Ca toti homodimerii “Zinc-finger” C4, acest factor de transcriptie poseda o simetrie de pliere rotationala; centrul de simetrie este avidentiat prin elipsa galbena. Cercurile negre indica ionii de Zn2+.

Din cursul anterior

Motivul zinc finger poate furniza un domeniu de legarea a ADN (poate constitui un domeniu de legare a ADN)

            Zinc fingers (degete cu zinc) si-au luat numele dupa structura pe care o poseda si care este ilustrata in figura 30.7 (Genes V). In aceasta, un mic grup de aminoacizi conservati leaga ionul de zinc , si formeaza un domeniu relativ independent in proteina. Doua tipuri de proteine care se leaga la ADN (DNA-binding proteins) au structuri de acest tip: proteinele clasice ‘zinc finger’ si receptorii steroidieni.

            O proteina ‘finger’ tipica are o serie de degete cu zinc, asa cum este prezentat in figura. Secventa consens a unui singur deget este:

            Cys-X2-4-Cys-X3-Phe-X5-Leu-X2-His-X3-His

            Motivul isi trage numele (si-a luat numele) de la bucla )loop) de aminoacizi care depaseste ca o protuberanta situsul de legare al zincului, care este descris ca un deget Cys2/His2. Zincul este prins intr-o structura tetraedrica formata prin conservarea resturilor de Cys si His. Degetul in sine contine aproximativ 23 aminoacizi, iar legatura dintre degete este, in mod normal, de 7-8 aminoacizi.

            Factorul de transcriptie TFIIIA (necesar ARN polimerazei III sa transcrie genele care codifica ARN 5S) contine o serie de 9 degete organizate in repetitii in tandem (tandem repeats= secvente repetitive in tandem). Trei repetitii ale secventei deget sunt prezente si in factorul de transcriptie SP1 care este implicat in initierea transcriptiei la mai multi promotori folositi de ARN polimeraza II. Degetele sunt necesare pentru legarea ADN (sau legarea la ADN).

            Este necesar sa se manifeste precautie la interpretarea prezentei (sau putativelor/posibilelor degete) degetelor cu zinc, mai ales cand proteina contine numai un singur motiv deget. Degetele mai pot fi implicate si in legarea la ARN (legarea ARN) sau chiar fara a fi corelate cu activitatea de reglare la vreun tip de acid nucleic.

            Prototipul proteinei cu degete (finger protein) este TFIIIA care se leaga atat la gena ADNr 5S cat si la produsul acesteia ARNr 5S. Un factor de initiere a translatiei eIF2b are un deget cu zinc; mutatiile la nivelul motivului deget influenteaza recunoasterea codonului de initiere. Proteinele capsidei retrovirale au un motiv inrudit cu motivul deget care poate fi implicat in legarea ARN viral.

            Degetele zinc au un motiv comun in proteinele care leaga ADN (care se leaga la ADN). De obicei, degetele sunt organizate ca o singura serie de unitati repetitive in tandem; ocazional exista mai mult decat un singur grup de degete. Regiunea degetelor variaza ca intindere de la o lungime de 9 repetitii, care ocupa aproape intreaga proteina (este cazul TFIIIA), la numai un mic domeniu care consta in doua degete (ca in cazul proteinei reglatoare ADT1 de la Drosophila)  Factorul general de transcriptie Sp1 poseda un domeniu de legare a ADN format din trei degete cu zinc.

            Structura cristalina a unui ADN legat la o proteina care contine trei degete cu zinc sugereaza structura ilustrata schematic in figura 30.8 (Genes V). Partea C-terminala a fiecarui deget formeaza un a-helix care leaga ADN; partea N-terminala formeaza o structura b-pliata. (Pentru simplificare conformatia b-pliata si localizarea ionului de zinc nu au mai fort configurate in partea de jos a figurii). Cele trei regiuni a-helix se potrivesc (se fixeaza) intr-o rasucitura (intoarcere/cotitura a fosei majore); fiecare a (si astfel fiecare deget realizeaza doua contacte specifice de secventa (secventa specifice) cu ADN (indicate prin sageti).

            Daca acest tip de structura este tipica degetelor cu zinc, ne putem astepta ca aminoacizii ne-conservati de la capatul C-terminal sa fie responsabili de recunoasterea specifica a situsurilor tinta. (De retinut ca ipoteze similare despre motivul helix-turn-helix prezent la represorii  de la procariote au fost dificil de sustinut, acum ezitand dubii (semne de intrebare) daca putem dovedi existenta unui cod care coreleaza secventele in aminoacizi ale elicei cu perechile de baze ale secventei ADN tinta.

            Cunoscand ca degetele cu zinc se gasesc in factori de transcriptie autentici care insotesc (asista) atat ARN polimeraza II cat si III, putem privi proteinele cu motive deget dintr-o perspectiva inversa. Cand se determina ca o proteina contine mai multe degete cu zinc, aceasta constituie cel putin prima premisa (prima facie) in sensul investigarii proteinei ca avand un posibil rol ca factor de transcriptie. Astfel s-a identificat ca diferiti loci implicati in dezvoltarea embrionara la D. melanogaster sunt reglatori ai transcriptiei.

            Receptorii hormonilor steroizi (si alte proteine) au un alt tip de motiv deget. Structura se bazeaza pe o secventa cu (un posibil/putativ) un situs consens de legare a zincului:

                                    Cys-X2-Cys-X1-3-Cys-X2-Cys

            Acestea sunt denumite degete Cys2/Cys2. Proteinele cu degete de acest tip au adesea degete ne-repetitive, in contrast cu repetitia in tandem a tipului Cy2/His2. Secventele de legare de pe ADN sunt scurte si palindromice. Analiza mutatiilor a aratat ca regiunile proteinelor reglatoare care se leaga la ADN includ motive finger.

            Degetele Cys2/Cys2 sunt distincte de degetele Cys2/His2. Studiile pe receptori steroidieni au aratat ca mutatiile care transforma cea de a doua Cys in His, schimband astfel tipul de deget, determina pierderea capacitatii de activare a genelor tinta. Deci cele doua tipuri de structuri sub forma de deget nu sunt interschimbabile.

            Receptorii pentru glucocorticoid si estrogen au fiecare cate doua degete, fiecare cu un atom de zinc in centrul tetraedrului format de cisteine. Cele doua structuri deget formeaza a-helixuri care se pliaza impreuna pentru a da nastere unui domeniu globular mare. Partile aromatice ale a-helixurilor formeaza impreuna un centru hidrofob unde o structura b-pliata conecteaza cele doua helixuri. O parte a helixului N-terminal vine in contact cu fosa majora a ADN. Doi receptori glucocorticoizi dimerizeaza pentru a se lega la ADN, si fiecare angajeaza o scobitura (rasucire/turnura) succesiva a fosei majore. Acest aspect este in concordanta cu natura palindromica a ‘elementului raspuns’.

            Fiecare deget controleaza o proprietate importanta a receptorului. In figura 30.9 sunt identificati aminoacizii relevanti (cu relevanta). Cei de pe partea dreapta a primului deget controleaza legarea la ADN; cei de pe partea stanga a celui de al doilea deget controleaza capacitatea de a forma dimeri.

            Dovezi directe privind legarea ADN la degete au fost obtinute printr-un experiment de ‘modificare a specificitatii’ (specificity swap). Motivul deget al receptorului pentru estrogen a fost inlaturat si inlocuit cu cel al unui receptor glucocorticoid. Noua proteina recunoaste secventa GRE (secventa obisnuita pentru un receptor glucocorticoid) in locul secventei ERE (secventa obisnuita pentru un receptor estrogen). Aceasta recunoastere stabileste specificitatea cu care este recunoscut ADN.

            Secventele GRE si ERE sunt destul de asemanatoare (similare), si alte experiente de ‘modificare a specificitatii’ au aratat ca diferentierea dintre ele consta in doi aminoacizi care sunt diferiti la primul motiv deget. Diferentele dintre secventele receptorului glucocorticoid si a celui estrogen sunt determinate in principal pe baza motivului deget. Asa cum am vazut, substituirea a doua dintre pozitiile marcate in figura 30.9 face ca receptorul glucocorticoid sa se lege la o secventa ERE in loc de una GRE.

Diapozitiv 55. Interactia dintre proteina C6 “zinc-finger”(Gal4) si ADN

Figura: Diagrama interactiei dintre gal4, o proteina “zinc-finger” C6, si ADN

Aceasta proteina se leaga la ADN ca un homodimer care interactioneaza pentru a forma o structura suprarasucita care se leaga perpenticular pe helixul ADN. Legarea resturilor de cisteina la doi ioni Zn2+ (in galben) pe fiecare monomer care formeaza cate un domeniu globular de legare la ADN.

Diapozitive 56. Interactia proteinei homodimere “leucine-zipper” si ADN

Figura: Doua imagini ale interactiunii factorului Gcn4 de la drojdii, o proteina homodimera “leucine-zipper”, cu ADN

Regiunile alfa-helix extinse ale monomerului prind ADN la nivelul a foselor majore adiacente. Domeniul suprarasucit de dimerizare al Gcn4 contine resturi de leucine precis pozitionate. Unele proteine de legare la ADN care contin acelasi model general contin alti aminoacizi hidrofobi in aceste pozitii; din aceasta cauza modelul prezentat aici se numeste modelul ”fermoar de leucina” de baza.   

Din cursul anterior

Motivele ‘leucine zipper’ pot fi implicate in formarea dimerilor

Interactiile dintre proteine constituie o tema comuna in constituirea complexului transcriptional. Un motiv gasit (caracteristic) mai multor factori de transcriptie (si altor proteine) este implicat atat in interactiile homo- cat si heterodimerice. Motivul ‘leucine zipper’ este o secventa (regiune/lungime) de aminoacizi bogata in resturi de leucina care furnizeaza un motiv dimer. Insasi formarea dimerilor a aparut ca un principiu comun in actiunea proteinelor care recunosc secvente specifice de ADN. In cazul ‘leucine zipper’ relatiile acestui motiv cu legarea ADN sunt clare, deoarece dimerizarea juxtapune regiunile de legare a ADN de pe fiecare subunitate. Reactia este prezentata sub forma unei diagrame in figura 30-18.

Un a-helix amfipatic prezinta o structura in care gruparile hidrofobe (inclusiv leucina) se orienteaza catre una dintre parti, in timp ce gruparile incarcate se orienteaza catre cealalta parte. Motivul ‘leucine zipper’ formeaza un helix amfipatic in care leucinele fermoarului unei proteine se pot intercala printre leucinele altui a-helix care apartine altei proteine paralele care poarta acelasi motiv (protuberantele leucinelor unei parti a fermoarului unei proteine se intercaleaza cu leucinele celeilalte parti a fermoarului celeilalte proteine dispusa paralel). Cele doua elice de ‘mana stanga’ (rasucite catre stanga) se rotesc una in jurul celeilalte, cu 3,5 resturi pe tura, astfel incat motivul se repeta integral dupa 7 resturi.

Cum se leaga aceasta structura la ADN ? Regiunea adiacenta resturilor repetitive de leucina este foarte bazica in fiecare proteina fermoar, si poate cuprinde situsul de legare a ADN. Cele doua fermoare leucina formeaza de fapt o structura in forma de Y, in care fermoarele constituie stemul (tulpina), iar cele doua regiuni bazice se bifurca simetric pentru a forma bratele care leaga ADN. Aceasta structura este cunoscuta drept motivul structural bZIP. Aceasta explica de ce secventele tinta ale unei astfel de proteine sunt repetitii inverse ne-separate intre ele (secvente repetitive inverse care nu sunt distantate intre ele).

Fermoarele pot fi utilizate pentru a sponsoriza (asigura formarea homodimerilor si heterodimerilor. Ele sunt motive lungi. Leucina ocupa fiecare al saptelea rest in potentialul motiv fermoar. In proteina C/EBP (factor care se leaga sub forma de dimer atat la ‘CAAT box’ cat si la miezul/core activatorului SV40) exista 4 repetitii, iar in factorii Jun si Fos (care formeaza factorul heterodimer de transcriptie, AP1). AP1 a fost original identificat ca o secventa care leaga ADN prezenta in activatorul (in regiunea activatoare) SV40 (Figura 29.10 Genes V).

Preparatul activ al AP1 include mai multe polipeptide. Un component major este Jun, produsul genei c-jun care a fost identificata prin relatia sa cu oncogena v-jun purtata de virusul sarcomului aviar. Genomul de soarece contine o familie de gene inrudite, c-jun (izolata original) si junB si junD (identificate datorita omologiei de secventa cu jun). Aceste trei proteine au o considerabila omologie de secventa; ele poseda motive ‘leucine zipper’ care pot interactiona pentru a forma homodimeri si heterodimeri.

Un alt component major al AP1 este produsul unei alte gene cu o copie oncogena. Gena c-fos este un omolog celular al oncogenei v-fos purtata de virusul sarcomului murin (virusul sarcomului de soarece). Expresia c-fos activeaza genele ai caror promotori poseda un situs tinta pentru AP1. Produsul c-fos este o fosfoproteina nucleara care face parte din acest grup de proteine. Celelalte au fost descrise ca fiind antigeni inruditi cu Fos (Fos-related antigenes = FRA); ele constituie familia proteinelor Fos (Fos-like proteins).

Fos are si ea un motiv ‘leucine zipper’, nu poate forma homodimeri dar formeaza un heterodimer cu Jun. Pentru reactie este necesar un motiv ‘leucine zipper’ pentru fiecare proteina. Capacitatea de a forma dimeri este partea cruciala (cea mai importanta) a interactiei acestor factori cu ADN. Fos singura nu poate lega ADN, probabil datorita incapacitatii sale de a forma dimeri. Heterodimerul Jun-Fos se poate lega la ADN cu aceeasi specificitate pentru secventa tinta ca si dimerul Jun-Jun;  acest heterodimer se leaga la situsul AP1 cu o afinitate de aproximativ 10 ori mai mare decat homodimerul Jun.

Unul dintre modelele imaginate presupune ca atat in cazul homodimerului Jun-Jun cat si al heterodimerului  Jun-Fos, ambele subunitati intra in contact cu ADN. Afinitatea crescuta a heterodimerului pentru ADN poate reflecta capacitatea situsurilor de legare ale subunitatilor Jun si Fos de a intra mai puternic in contact cu ADN fata de situsurile celor doua subunitati Jun.

Diapozitiv 57. Interactia proteinei homodimere “helix-loop-helix” si ADN

Figura: Interactia domeniului HLH (“helix-loop-helix”) din proteina homodimera Max cu ADN

Motivul HLH se extinde si dincolo de elicele de legare la ADN, in stanga (capetele N-terminale ale monomerilor) pana in apropierea regiunii de rasucire a catenelor; aceasta regiune este urmata imediat de o regiune de rasucire de tip “leucine Zipper” in proteina dimera.

Din cursul anterior

Proteinele ‘helix-loop-helix’ interactioneaza prin asociere combinata

            Cele doua trasaturi comune ale proteinelor care se leaga la ADN sunt prezenta regiunilor sub forma de helix care leaga ADN, si capacitatea proteinei de a dimeriza. Ambele trasaturi sunt caracteristice si grupului de proteine ‘helix-loop-helix’ care contin un tip comun de motiv de secventa: o regiune (intindere) de 40-50 de aminoacizi contin doua a-helixuri amfipatice separate de o regiune de legare (linker region=the loop), bucla, care are o lungime variabila. Proteinele din acest grup formeaza atat homodimeri cat si heterodimeri prin intermediul interactiunilor care se stabilesc intre resturile hidrofobe situate pe fetele (partile) corespunzatoare celor doua helixuri. Regiunile sub forma de helix au o lungime de 15-16 aminoacizi, fiecare continand mai multe resturi conservate. Doua exemple sunt comparate in figura 30.16. Capacitatea de a forma dimeri rezida (se afla) in aceste helixuri amfipatice, si este comuna tuturor proteinelor HLH (helix-loop-helix). Bucla este probabil importanta numai pentru a oferi libertate celor doua regiuni sa interactioneze independent una de cealalta.

            Majoritatea proteinelor HLH contin o regiune adiacenta motivului HLH care este foarte bazica, si care este necesara pentru legarea ADN. Pe o lungime de 15 aminoacizi aproximativ 6 resturi sunt conservate. Membrii grupului care contin o astfel de regiune sunt numiti proteine bHLH. Se pot lega la ADN atat un homodimer cat si un heterodimer in care ambele subunitati contin o regiune bazica. Se pare ca domeniile HLH au rolul de a orienta corect cele doua regiuni bazice continute de subunitatile individuale. Nu se cunoaste inca mult despre modalitatea in care proteinele HLH activeaza transcriptia.

            Membrii grupului bHLH includ: doua proteine E12 si E47 care se leaga la un element prezent intr-un activator al genei imunoglobulinelor, myoD, miogenina, factorul de transcriptie myf-5 care este implicat in miogeneza (formarea muschiului), genele myc (care sunt copii/dubluri ale oncogenelor implicate in reglarea cresterii), si un grup de gene care specifica (sunt responsabile) dezvoltarea sistemului nervos la D. melanogaster.

            Proteinele bHLH se impart in doua subgrupe (categorii) generale:

- clasa A consta in proteinele care sunt exprimate ubicuitar, incluzand proteinele E12/E47 de la mamifere si musca da (musca domestica);

- clasa B consta in proteine care sunt exprimate specific in functie de tesut, care includ Myo D de la mamifere si AC-S de la musca domestica. Proteinele clasei bHLH tesut specifice pot fi factori de reglare transcriptionali (reglatori transcriptionali) care functioneaza mult mai eficient prin formare de heterodimeri cu un partener cu distributie ubicuitara. Nu se cunoaste daca acesta este singurul tip de activitate, sau daca homodimerii formati de proteinele bHLH ubicuitare sunt uneori folosite pentru a regla transcriptia. Proteinele myc formeaza o categorie (clasa) separata de proteine bHLH ai caror parteneri si secvente tinta sunt diferite.

Dimerii formati de proteinele bHLH difera prin capacitatea lor de a se lega la ADN. De exemplu, homodimerii E47, heterodimerii E12-E47, si MyoD-E47 se formeaza eficient si se leaga puternic la ADN. E12 homodimerizeaza bine dar se leaga slab la ADN, in timp ce homodimerii MyoD homodimerizeaza destul de slab. Astfel, atat formarea dimerilor cat si legarea ADN pot reprezenta punte reglatoare importante. In aceasta conjunctura, este posibila definirea unor grupuri de proteine HLH ai caror membri formeaza diferite tipuri de combinatii (tipuri de imperecheri/cuplaje), dar nu pentru prezice secventele cele mai puternic implicate in formarea dimerilor sau legarea ADN. Toti dimerii acestui grup care leaga ADN recunosc aceeasi secventa consens. Nu se stie inca daca diferitii homo- sau heterodimeri manifesta preferinte pentru situsurile tinta usor diferite care sunt corelate cu functiile lor.

Diferentele de legare a ADN sunt determinate de proprietatile regiunii situate in sau din apropierea motivului HLH; de exemplu, E12 difera de E47 prin faptul ca poseda o regiune inhibitoare chiar dupa regiunea bazica si/sau contine resturi de prolina care par sa-i deranjeze functia. Exemplul proteinei Id este prezentat in figura 30.16 (Genes V). Proteinele de acest tip au aceeasi capacitate de dimerizare ca si proteinele bHLH, dar un dimer care contine o subunitate de acest tip nu se mai poate lega specific la ADN. Aceasta reprezinta o demonstratie eficace (puternica) a importantei dublarii motivelor de legare a ADN in proteinele care se leaga la ADN (sau care leaga ADN).

Importanta distinctiei dintre proteinele ne-bazice HLH si bHLH este sugerata de proprietatile a doua grupe de proteine HLH: grupul da-AC-S/emc si tipul Myo/Id. Un model al functionarii acestora este ilustrat in figura 30.17 (Genes V).

La D. melanogaster, gena emc (extramacrochaetae) este necesara pentru stabilirea orientarii normale a organelor senzoriale adulte. Ea functioneaza prin suprimarea functiilor mai multor gene inclusiv da (daughterless) (care impiedica formarea de progenituri) si a complexului AC-S (achaete-scute), care in caz contrar (altfel) determina celulele aditionale (complementare/suplimentare) sa nu urmeze acest destin. AC-S si da sunt gene care apartin tipului bHLH. Supresorul emc codifica pentru o proteina HLH careia ii lipseste regiunea bazica. Se presupune ca, in absenta functiei emc, proteinele da si AC-S formeaza dimeri care activeaza transcriptia unor gene tinta adecvate, dar producerea proteinei emc determina formarea heterodimerilor care nu pot lega ADN. Astfel, producerea proteinei emc in celule adecvate (in anumite celule) este necesara pentru a suprima functia AC-S/da.

Formarea celulei musculare este dirijata (orientata/directionata) de o modificare in programul transcriptional care necesita numeroase proteine bHLH, inclusiv MyoD. MyoD este produsa specific in celulele cu functie miogenica; s-a constata ca super-exprimarea MyoD in orice alta celula poate induce inceperea unui program miogenic. Semnalul (declansatorul ,mecanismul responsabil de declansare) diferentierii celulare este mai probabil un heterodimer care consta in MyoD-E12 sau MyoD-E47 decat un homodimer MyoD/MyoD. Inainte de inceperea miogenezei, un membru al tipului de proteine HLH ne-bazice, proteina Id, se poate lega la MyoD si/sau E12 si E47 pentru a forma heterodimeri care nu pot lega ADN. Acestea se leaga la E-12/E47 mai bine decat la MyoD, si poate functiona prin sechestrarea partenerului bHLH ubicuitar. Supraexpresia Id poate impiedica miogeneza. Astfel, indepartarea Id poate fi semnalul care elibereaza MyoD pentru a initia miogeneza.

            Comportamentul proteinelor HLH este ilustrat in doua principii generale ale reglarii transcriptiei. Un mic numar de proteine formeaza asocieri combinate; este posibil ca aceste combinatii particulare sa aiba diferite functii in ceea ce priveste legarea ADN si reglarea transcriptiei, dar pentru moment nu sunt intelese in intregime functiile relative ale proteinelor bHLH specifice unui anumit tesut si ubicuitare. Membrii aceleiasi clase de proteine pot functiona ca supresori prin participarea la alte combinatii asociative. Diferentierea poate depinde fie de prezenta fie de indepartarea unor proteine supresor particulare (anumitor proteine supresor) apartinand clasei HLH de proteine ne-bazice.

Diapozitiv 58. Factorii transcriptionali heterodimeri cresc optiunile controlului genetic

Figura: Posibilitati de combinare datorate formarii factorilor de transcriptie heterodimeri

a)      In modelul ipotetic prezentat, factorii de transcriptie A, B si C fiecare interactioneaza unul cu celalalt, permitand celor trei factori sa se lege la 6 secvente diferite de ADN (situsurile 1-6) si creaza 6 combinatii ale domeniilor de activare (de retinut ca fiecare situs de legare este impartit in doua jumatati de situsuri si ca un singur factor heterodimer contine domeniile de activare al fiecaruia dintre monomerii constituenti). Patru factori monomeri diferiti se pot combina pentru a forma 10 factori homo si heterodimeri; cinci monomeri vor duce la formarea a 15 factori dimeri si asa mai departe;

b)       Cand un factor inhibitor (in verde) se considera ca interactioneaza numai cu factorul A, situsurile de legare 1, 4 si 5 sunt inhibate dar situsurile 2, 3 si 6 nu sunt afectate

Factorii de transcriptie heteodimeri cresc optiunile de control ale genelor

Trei tipuri de proteine de legare la ADN discutate anterior pot forma heterodimeri: proteinele “Zn finger” C4 , proteinele bazice “zipper” si proteinele “helix-loop-helix”. Alte clase de factori de transcriptie ale caror structuri nu sunt considerate specific formeaza si ele proteine heterodimere. In unii factori de transcriptie heterodimeri, fiecare monomer poseda un domeniu de legare a ADN cu specificitate de secventa echivalenta, dar rareori permite domeniilor de activare asociate cu fiecare monomer sa fie adunate impreuna intr-un singur factor de transcriptie. Totusi, daca monomerii poseda diferite specificitati de legare la ADN, formarea heterodimerilor creste numarul de secvente potentiale de ADN pe care factorii le pot lega.

In plus, exista exemple proteine inhibitoare bazice “zipper” sau de “helix-loop-helix” care blocheaza legarea ADN cand dimerizeaza cu un partener polipeptidic normal capabil sa lege ADN. Cand acesti factori inhibitori sunt exprimati, ei represeaza activarea transcriptionala prin intermediul factorilor cu care ei interactioneaza.

            Regulile care guverneaza interactiile membrilor unei clase de factori de transcriptie sunt complexe. Aceasta complexitate combinationala poate fi extinsa si numarului de situsuri ADN la nivelul carora acesti factori pot activa transcriptia dar si modalitatilor prin care aceasta poate fi reglata. Acest lucru nu este posibil pentru factorii de transcriptie care se leaga sub forma de monomeri sau homodimeri.

 

Diapozitiv 59. Domeniile de activare manifesta o considerabila diversitate structurala

Figura 1: Structura domeniului fosforilat de activare acid CREB complexat cu domeniul sau de interactiune si co-activatorul sau CBP

Structura polipeptidica a domeniului activator fosyforilat acid al CREB este reprezentat sub forma unei spirale roz. Resturile de aa din CREB care interactioneaza cu suprafata CBP sunt indicate prin abrevieri cu o singura litera. Suprafata domeniuli de interactie cu CBP accesibila apei este reprezentata in spatele figurii cu regiuni de potential pozitiv si negativ prezentate in albastru si rosu.

  Figura 2: Efectul legarii ligandului asupra conformatiei domeniilor de legare a liganzilor in cazul a doi receptori nucleari inruditi de la om. Structura determinate prin cristalografie cu raze X.

 a) In absenta legarii ligandului (acid 9-cis retinoic), domeniul de legare a domeniului in receptorul RXRalfa prezinta o conformatie deschisa . In aceasta forma, el functioneaza ca un domeniu represor;

b) Cand se leaga la all-trans acid retinoic , domeniul de legare a ligandului din receptorul uman RARgama are o conformatie compacta . In aceasta forma acesta poate stimula transcriptia.

Cilindrii reprezinta alfa-helixurile . Regiunile domeniului de legare a ligandului care nu isi schimba semnificativ conformatia datorita legarii ligandului sunt reprezentate in verde iar regiunile care o fac in galben.

Domeniile de activare manifesta o considerabila diversitate structurala

Un domeniu de activare este o secventa polipeptidica care activeaza transcriptia cand fuzioneaza cu un domeniu de legare la ADN. De exemplu, un numar mare de secvente polipeptidice pot activa transcriptia in celule eucariote de la un promotor care poseda in amonte situsuri UASGAL care leaga domeniul de legare la ADN al Gal4. S-a constatat ca aprox 1% din proteinele de fuziune compuse din domeniul Gal4 de legare la ADN si segmente aleatoare ale proteinelor activatoare de la E. coli., activeaza transcriptia la nivelul unui promotor de la drojdii si mamifere care poseda in amonte o secventa UASGAL.

Aceste rezultate demonstreaza ca un grup divers de secvente peptidice pot functiona ca domenii de activare, chiar daca aceste au alte functii in mod obisnuit. Cu toate aceste multe domenii de activare poseda un procentaj crescut de aminoacizi particulari. De exeplu Gal4 si Gcn4 ca si majoritatea factorilor de transcriptie de la drojdii sunt foarte bogati in acid aspartic si acid glutamic. Acestea sunt numite si domenii acide de activare si sunt capabile sa activeze transcriptia aproape pentru toate tipurile de celule animale, fungi, plante.

Studii biofizice recente pe modele de activatori acizi evidentiaza ca exista ca structuri polipeptidiced nestructurate, pliate la intamplare pana in momentul in care acestia interactioneaza cu o proteina co-activator. Aceasta interactiune induce plierea domeniului de activare intr-o structura alfa-helix amfipatica care intra in contact cu o suprafata complementara a proteinei co-activatoare.

Diapozitiv 60. Complexele multiproteice actioneaza la nivelul “enhancer”-ilor

Figura: Model de “enhanceozome” (complex activator) care se formeaza la nivelului “activatorului” pentru beta-interferon.

            Heterodimerii cJun/AFT2 (Activation Transcription Factor 2), IRF-3, IRF-7(iron responsive elements/iron binding protein or iron responsive factors) si NF-kB (un heterodimer format din p50 si p65) se leaga la cele 4 elemente de control ale “activatorului” de aproximativ 70 pb. Legarea cooperativa a acestor factori de transcriptie este facilitata de HMGI care se leaga la fosa minora a ADN. Proteinele c-jun, AFT-2, p50 si p65 toate par sa interactioneze direct cu o HMGI pozitionata in apropierea lor. Plierea secventei activatoare determinata de legarea HMGI este critica pentru formarea “enhanceozomului” (complexului activator). Alte proteine care se leaga la ADN si determina plierea actioneaza similar la nivelul altor activatori.

            Protooncogenele C-jun si c-fos codifica proteine care uneori se asociaza pentru a forma un factor de transcriptie heterodimer, numit AP1 care se leaga la secvrente din regiunea promotoare si activatoare a diferitelor gene. Atat Fos cat si Jun pot actiona independent ca factori de transcriptie.

            NF-kB (factorul nuclear pentru transcriptia lanturilor k in celulele B) este un factor de transcriptie heterodimer care a fost descoperit in urma unor experimente biochimice pornind de la necesitatea acestui factor de catre celulele B pentru transcriptia lanturilor k ale imunoglobulinelor. NF+kB este un heterodimer format din doua proteine inrudite p50 si p65. Aceste proteine manifesta o regiune de omologie la capetele lor N-terminale care este necesara pentru legarea ADN si dimerizare.

            Complexele multiproteice se formeaza la nivelul “enhancerilor”

            “Enhancerii” sau activatorii sunt in general secvente cu o lungime cuprinsa intre 50 si 200 pb si contin numeroase situsuri de legare a factorilor transcriptionali.

            Factorii transcriptionali multipli care se leaga la un singur activator se considera ca interactioneaza. Analizele activatorului care regleaza expresia beta-interferonului, o proteina importanta implicata in apararea organismului uman fata de infectiile virale, furnizeaza un bun exemplu privind modul de interactiune al acestor factori. La nivelul acestui activator de aproximativ 70 pb au fost identificate patru elemente de control prin analiza mutationala. Studii mai detaliate au evidentiat ca factorii care recunosc activatorul se leaga simultan. In prezenta unei proteine mici abundente asociata cu cromatina, numita HMGI(high-mobility-group), legarea factorilor de transcriptie este inalt cooperativa, similara cu legarea proteinei CAP de la E. Coli si a ARN polimerazei in regiunea promotorului operatorului lac. Aceasta legare cooperativa duce la formarea unui complex multi-proteic la nivelul activatorului ADN. Termenul de “enhaceozom” a fost desemnat pentru a denumi astfel de complexe nucleoproteice asamblate din factori transcriptionali in momentul in care acestia se leaga cooperativ la situsurile multiple de legare din structura activatorilor. 

            HMGI se leaga la fosa minora a ADN indiferent de secventa si are drept rezultat indoirea rapida a moleculei de ADN. Aceasta pliere a “activatorului” ADEN permite factorilor de transcriptie sa interactioneze adecvat (curat). Interactiile relativ slabe dintre proteinele legate sunt activate datorita legarii factorilor de transcriptie in zonele vecine, mentinand proteinele la o concentratie relativa foarte ridicata.

            Studiile realizate cu activatorii genei receptorului alfa din celulele T, de asemenea important in raspunsul imun, asamblarea “enhaceozomului” s-a determinat a fi dependenta de o alta proteina (diferita de HGMI) care interactioneaza cu fosa minora a ADN si induce o curbura. Astfel de proteine implicate in indoirea ADN au fost denumite “proteine arhitecturale”, dearece sunt necesare pentru constructia acestor complexe nucleoproteice. 

Diapozitiv 61. Multi represori interactioneaza cu activatorii

Ø      Transcriptia de la eucariote este reglata de represori cat si de activatori ;

Ø      Situsurile de legare a represorilor pot fi identificate si represorii purificati prin aceleasi tehnici folosite pentru activatori;

Ø      Multi represori din sistemele eucariote poseda doua domenii: un domedniu de legare a ADN si un domeniu represor

Studii genetice si biochimice au demonstrat ca transcriptia la eucariote este reglata atat prin proteine represoare cat si activatoare. De exemplu, geneticienii au identificat mutatii la drojdii care au implicatii in exprimarea constitutiva a anumitor gene, indsicand ca aceste gedne sunt in mod normal reglate de catre un represor. In alte studii, au fost identificate situsuri de legare arepresorilor prin analize mutationale sistematice ale regiunilor implicate in procesul de transcriptie de la eucariote, similare cu cele realizate pentru procariote. In timp ce o mutatie la nivelul unui situs de legare a activatorilor conduce la descresterea expresiei genei raportor corelate, mutatia la nivelul situsului de legare a represorului conduce la cresterea expresiei genei raportor. Proteinele represoare care se leaga la astfel de situsuri au fost purificate si caracterizate folosind cromatografie de afinitate si secvente specifice, ca si in cazul proteinelor activatoare.

            Absenta unei activitati represoare adecvate poate avea consecinte devastatoare. De exemplu, proteina codificata de catre gena WT1 (tumoarea Wilm) este un represor care se exprima preferential in dezvoltatrea rfinichiului. Copii care mostenesc mutatii atat la nivelul genei materne cat si paterne a WT1, nu vor produce o proteina functionala WT1 si vor dezvolta invariabil tumori renale de foarte timpuriu. Proteina WT1 care are un domeniu de legare a ADN de tip “C2H2 zinc finger”, se leaga la regiunea control a genei care codifica un factor de transcriptie numit EGR-1. Aceasta gena asemeni altor gene de la eucariote este supusa atat activarii cat si represarii. Legarea WT1 represeaza transcriptia genei EGR-1 fara a inhiba legarea a doi activatori care in mod normal stimuleaza expresia acestei gene. Represorii transcriptionali eucariotici de tipul WT1 par sa fie opusii functionali ai activatorilor. Ei pot inhiba transcriptia unei gene pe care ei in mod normal nu o regleaza cand situsul lor de recunoastere este plasat intr-un intervalul de cateva sute de perechi de baze fata de situsul de start al genei respective.

            Assemeni activatorilor, multi represori prezinta doua domenii functionale: domeniul de legare si domeniul de represare. Asa cum se intampla si in cazul domeniilor activatoare, o varietate de secvente de aminoacizi pot functiuona ca domenii represoare. Multe dintre acestea sunt relativ scurte (de aproximativ 20 aminoacizi) si contin portiuni intinse de animoacizi hidrofobi. Alte domenii represoare contin portiuni mari de aminoacizi bazici. In unele cazuri, domeniile represoare sunt mai mari si bine structurate. De exemplu, in absenta ligandului, domeniul de legare RXRalfa functioneaza ca un domeniu represiv. Cand acelasi domeniu leaga ligandul sau de recunoastere acidul 9-cis retinoic, el este transformat intr-un domeniu de activare. Ca si pentru domeniile de activare, diferitele structuri ale domeniilor represoare sunt probabil a reflectare a mai multor posibile mecanisme de a reglare a transcriptiei la eucariote.  

Diapozitiv 62. Concluzii

Factorii de transcriptie, care stimuleaza sau reprima transcriptia, se leaga la elemente situate in proximitatea promotorului si la “enhancers”(activatori) din structura ADN la eucariote;

            Activatorii sunt in general proteine modulare, care contin un singur domeniu de legare si unul sau mai multe domenii activatoare; diferitele domenii sunt adesea legate prin regiuni polipeptidice flexibile. Acestea permit domeniilor diferitilor activatori sa interactioneze chiar si cand domeniile de legare la ADN recunosc situsuri separate de zeci de perechi de baze;

            Activatorii contin, in general, mai multe situsuri de legare pentru factorii de transcriptie

grupate sub forma de clustere. Legarea cooperativa a mai multor activatori la situsuri invecinate din structura unui activator formeaza un complex multi-proteic numit “complex activator”. Asamblarea acestuia necesita adesea proteine mici care se lreaga la fosa minora a ADN si determina curbarea rapida a secventei permitand proteinelor de pe fiecare parte a curburii sa interactioneze mult mai bine;

            Majoritatea represorilor de la eucariote sunt proteine modulare. Similar cu activatorii, acestia contin de obicei un singur domeniu de legare si unul sau mai multe domenii represoare, si pot controla transcriptia cand sunt legati la situsuri situate la sute sau mii de baze fata de situsul de start;

            Domeniile de legare la ADN ale factorilor de transcriptie de la eucariote exprima o varietate de structuri. Printre cele mai comune motive structurale sunt homeodomeniile, domeniile bazice “fermoar de leucina” (leucine zipper), HLH si diferite tipuri de degete zinc (zinc finger). In general una sau mai multe alfa-elice din domeniul de legare la ADN interactioneaza cu fosa majora la nivelul unor situsuri de recunoastere;

            Capacitatea anumitor factori de transcriptie de a forma heterodimeri creste numarul de situsuri ADN pe care acesti factori le pot controla si modalitatile prin care le pot controla;

            Desi anumite domenii de activare si de represare sunt bogate in aminoacizi particulari, aceste domenii functionale manifesta o varietate de secvente de aminoacizi si structuri proteice caracteristice diferitilor factori transcriptie. 

Diapozitiv 63. Complexul ARN polimerazic II de initiere a transcriptiei

Ø      Initierea de catre Pol II necesita factori generali de  transcriptie, care pozitioneaza Pol II la nivelul situsului de initiere si sunt necesari pentru transcrierea marii majoritati

a genelor transcrise de catre aceasta polimeraza;

Ø      Factorii generali de transcriptie sunt structuri multimere si inalt conservate;

Ø      Proteinele cuprinse in complexul Pol II de initiere a  transcriptiei se asambleaza intr-o ordine specifica “in vitro”  dar majoritatea proteinelor se pot combina pentru a forma un complex holoenzimatic “in vivo”.

Anterior am discutat ca ARN polimeraza  de la E. Coli lipsita de subunitatrea sigma70 nu poate initia transcriptia. Totusi, cand “core” polimeraza este asociata cu subunitatea sigma70, holoenzima rezutata poate initia transcriptia in vitro pornind de la promotori puternici. Astfel, subunitatea sigma70 functioneaza ca un factor de initiere care este absolut necesar pentru inceperea transcriptiei si care este eliberat de pe matrita o data ce s-a produs polimerizarea primilor aproximativ 10 ribonucleotidtrifosfati.

Din contra, transcriptia in vitro cu ARN polimeraza II purificata necesita adaugarea unui numar mare de factori de initiere care sunt separati de complexul polimerazic in timpul purificarii. Acesti factori de initiere, care pozitioneaza ARN polimeraza II la la nivelul situsurilor de initiere a transcriptiei, sunt numiti factori generali de transcriptie, deoarece se considera ca ei sunt necesari pentru transcriptia majoritatii genelor de catre acest tip de polimeraza. Un complex de initiere a transcriptiei contine ARN polimeraza  si diferiti factori generali implicati in transcriptie care se leaga al regiunea promotoare.

            Multi dintre factorii generali de transcriptie necesari polimerazei II pentru initierea transcriptiei de la nivelul majoritatii promotorilor care contin o TATA box au fost izolati si caracterizati.

Aceste proteine au fost desemnate cu terminologia TFIIA, TFIIB, etc, majoritatea fiind proteine multimere. TFIID este unul dintre cei mai mari factori avand o masa moleculara de aprox 750 kDa. Acesta contine o singura proteina de aprox 38 kDa numita TATA  box-binding protein (TBP) si 11 factori asociati TBP numiti TAF (TATA Asociated factors) care nu au fost foarte bine caracterizati. Factori generali de transcriptie cu activitati similare au fost izolati din celule umane in cultura, ficat de sobolan, embrfioni de Drosophila, si drojdii. Genele care codifica aceste proteine la drojdii au fost secventializate o data cu secventializarea completa a genomului de drojdii ca si in cazul ADNc uman si a celui de la Drosophila. In toate cazurile, factorii de transcriptie echivalenti de la diferitele tipuri de eucariote sunt foarte bine conservati. Desi factorii generasi de transcriptie permit polimerazei II sa initieze transcriptia in vitro la nivelul acelorasi situsuri prezente in vivo, proteine aditionale sunt necesare pentru initierea transcriptiei in vivo.

Diapozitiv 64. Etapele procesului de asamblarea a complexului Pol II de initiere a transcriptiei in vitro

Figura: Etapele asamblarii complexului de initiere atranscriptiei pornind de la ARN pol II ti factori de transcriptie izolati.

            O data ce intreg complexul de initiere a fost asamblat, se produce separarea catenelor ADN la situsul de start pentru a forma complexul deschis care necesita hidroliza ATP. O data ce transcriptia initiaza si transcriptia incepe sa se deruleze de la nivelul prpmotorului, CTD se fosforileaza si factorii generali de transcriptie disociaza de complexul de legare TBP de la nivelul promotorului. Numeroase alte proteine participa la initierea transcriptiei in vivo.

            In majoritatea studiilor biochimice asupra asanblarii complexului de initiere al Pol II, cercetatorii au folosit mai degraba TBP (TATA binding protein) decat complexul TFIID coimplet format din multe subunitati si care este dificil de purificat. Legarea TBP si a altor factori generali de transcriptie la promotorii cu secvente consens TATA a fost analizata prin tehnica de “foot-printing” cu DN-aza I si prin tehnica electroforetica de intarziere in gel. Aceste studii demonstreaza ca complexul PolII de initiere este asamblat in vitro in conformitate cu secventa de reactii determinata si prezentata in imagine.

            In vitro, TBP este prima proteina care se la promotorul TATA box. Toate proteinele eucariote TBP analizate prezinta domenii C-terminale foarte similare de aproximativ 180 de aminoacizi.  Secventa acestei regiuni prezinta o omologie de 80%  de la drojdii la om, majoritatea diferentelor fiind substitutii conservative. Acestea conserva functiile domeniului C-terminal ca si intreaga lungime a proteinei in urma transcriptiei in vitro. Domeniul N-terminal al TBP, care variaza foarte mult ca secventa si lungime la diferite eucariote, functioneaza in transcriptia genelor care codifica pentru ARNsn.

Diapozitiv 65. Domeniile C-terminale conservate ale TBP de legare la TATA-box DNA

Figura: Structura domeniului C-terminal al TBP legat la ADN TATA-box.

Desi TBP este un monomer, lantul polipeptidic al acestui domeniu este pliat intr-o conformatie care are o simetrie bilaterala. Totusi, resturile de de suprafata ale proteinei se disting clar in doua parti. TBP se leaga la fosa minora a ADN TATA-box, distorsionand structura normala a dublului helix indoind dramatic ADN.

            Figura se bazeaza pe analizele de cristalografie cu raze X si demonstraza legarea la TATA-box. Asemeni HMGI si altor proteine care produc indoirea ADN care participa la formarea “enhanceozomului” sau complexului de activare.

            O data ce TBP se leaga la TATA-box, se poate lega si TFIIB care este o proteina monomer mai mica decat TBP. Domeniul sau C-terminal vine in contact atat cu ADN cat si cu TBP. Domeniul N-terminal al al TFIIB se extinde catre situsul de start, dar structura sa tridimensionala nu este inca cunoscuta. Dupa plierea TFIIB, un complex pre-format din TFIIF (un tetramer alfa2beta2) si Pol II se leaga si pozitioneaza polimeraza peste situsul de start. In complexul de preinitiere, care este stabil, cele doua subunitati mai mari ale Pol II (L si L’) interactioneaza cu promotorul ADN de-a lungul unui canal de aproximativ 240 A care se extinde in amonte si in aval de situsul de start. La majoritatea promotorilor, se leaga inca doi factori generali inainte de separarea duplexului ADN  si expunerea catemei matrita. Primul care se leaga este TFIIE (un tetramer alfa2beta2) care creaza un situs de legare pentru TFIIH, un alt factor multimer care contine noua subunitati. Legarea TFIIH completeaza complexul de initiere a transcriptiei in vitro.

            In prezenta ATP, se manifesta activitatea helicazica a TFIIH care desface duplexul ADN la nivelul situsului de start, permitand ADN Pol II iformarea complexului deschis. Daca sunt adaugati nucleotidtrifosfati Pol II incepe transcriptia matritei. In timp ce polimeraza incepe transcrierea dincolo de regiunea promotoare o alta subunitate a TFIIH fosforileaza Pol II CTD la multiple situsuri.

Complexele minimale de transcriptie in vitro contin numai aceste elemente generale si Pol II purificata. Dupa initiere TBP ramane legata la TATA-box in timp ce polimeraza realizeaza transcriptia dincolo de promotor in timp ce ceilalti factori disociaza. Asa cum am discutat se pare ca in vivo transcriptia necesita si alti factori transcriptionali; nu este clar care dintre factori raman asociati cu regiunea promotoare dupa initiere.

Diapozitiv 66. Modelul structural al complexului promotor ADN, TBP, TFIIB, si Pol II

Figura: Modelul structural al complexului compus din promotorul ADN, TBP, TFIIB si ARN polimreraza II indicand marimile relative ale componentelor.

            Cele doua vederi ale complexului cu 180o din fata si din spate. 

Diapozitiv 67. Concluzii        

ARN polimeraza II necesita mai multi factori generali de transcriptie pentru a localiza clar punctul de start la nivelul matritei ADN si a initia transcriptia. Acestea includ TFIID care se leaga la TATA-box prin intermediul TBP;

            Transcriptia genelor care codifica pentru proteine este controlata de catre ARN polimeraza II care poate fi initiata in vitro prin legarea secventiala a factorilor: TBP, care se leaga la TATA-box; TFIIB; un complex Pol II si TFIIH; TFIIE; si final TFIIH;

            Activitatile helicazice ale celor doua subunitati TFIIH separa catenele la nivelul situsului de start la majoritatea promotorilor, un proces care necesita hidroliza ATP. Dupa ce pol II incepe transcrierea dincolo de situsul de start, elementele CTD sunt fosforilate de catre o alta subunitate a TFIIH;

            Initierea de catre Pol II in vivo necesita un complex multimediator multiproteic, care se asociaza cu elementele CTD nefosforilate ale Pol II, formand un mare complex holoenzimatic care include si majoritatea factorilor de transcriptie. Se crede ca aceasta holoenzima preasamblata se leaga la ADN promotor intr-o singura etapa in vivo;

            Complexul de initiere a transcriptiei care se asambleaza la nivelul promotorilor in vivo poate cuprinde 60-70 polipeptide cu o masa totala similara cu cea a unui ribozom.       

Diapozitiv 68. Mecanismele moleculare ale controlului transcriptional la eucariote

Controlul transcriptional in celulele eucariote poate fi vizualizat ca implicand numeroase nivele de reglare. Concentratiile si activitatile activatorilor si represorilor care controleaza transcriptia multor gene care codifica pentru proteine sunt reglate in timpul diferentierii celulare si ca raspuns la hormoni si la semnalele celulelor inconjuratoare.

            Acesti activatori si represori regleaza in schimb si modificarile in structura cromatinei si in acetilarea si deacitilarea histonelor, influentand astfel capacitatea factorilor generali de transcriptie sa se lege la promotori. In plus, activatorii si represorii regleaza direct asamblarea complexelor de initiere a transcriptiei.

            Reglarea prin controlul structurii cromatinei

Cromatina-Nucleosomi (care contin 146 pb ADN)-fibre de cromatina de 30 nm.

            Capetele N-terminale ale fiecarei histone (20-60 aminoacizi in functie de fiecare histona) se extind catre suprafata nucleosomului. Aceste capete histonice N-terminale sunt bogate in resturi de lizina care pot fi modificate reversibil prin acetilare, fosforilare si metilare ca si prin adaugarea unei molecule singulare de ubiquitina, o proteina inalt conservata de 76 de resturi.

            Fosforilarea are un rol important dar este inca putin inteleasa functia sa in condensarea cromozomului in timpul mitozei. Functiile altor modificari sunt de asemenea putin intelese, cu exceptia acetilarii. Acetilarea histonelor N-terminale este asociata cu controlul genetic in timpul interfazei. Alte proteine mai putin abundente decat histonele sunt si ele asociate cu cromatina. Acestea includ proteinele HMG care participa la formarea “enhanceozomilor” (complexelor activatoare). 

Figura: Genele de pe cromozomul III implicate in controlul conjugarii (mating) la drojdii (S. Cerevisiae)

            Genele silentioase (ne-exprimate) implicate in conjugare (fie a sau alfa in functie de susa) sunt localizate pe locusul HML. Genele de tip opus sunt prezente pe locusul silentios HMR. O data la fiecare diviziune celulara, secvednta ADN de pe HML este transferata locusului MAT; in diviziunile celulare alternative, secventa ADN de pe HMR este transferata locusului MAT. Cand secventele alfa si a sunt prezente la locusul MAT, ele pot fi transcrise in ARNm ale caror proteine codificate sunt factori de transcriptie care regleaza expresia genelor specifice implicate in conjugare. Secvente silentioase de legare a proteinelor situate langa HML si HMR leaga proteinele care sunt critice pentru represia acestor loci silentiosi.

Diferite experimente au demonstrat ca represia locilor HML si HMR este rezultatul condensarii structurale a cromatinei care blocheaza steric interactia factoriilor de transcriptie cu ADN. ADN din structura locilor silentiosi este inaccesibil proteinelor in general (nici macar metilazei), inclusiv factorilor de transcriptie si ARN polimerazei. Studii asupra regiunilor N-terminale ale histonelor H3 si H4 au evidentiat ca acestea derepreseaza locii silentiosi, lasand de exemplu Dam metilaza sa aiba acces la secventele GATC din strunctura HML si HMR. Aceste rezultate indica ca interactiile specifice care implica regiunile N-terminale ale histonelor H3 si H4 sunt necesare pentru represia la nivelul locilor silentiosi de conjugare.

Diapozitiv 69. Numeroase gene codifica proteine care leaga locii silentiosi specific la nivelul telomerilor de drojdii

Figura: Co-localizarea proteinei Sir3 cu heterocromationa telomerica in nucleii de drojdii

a)      Micrografii confocale pentru trei celule diploide de droijdii, fiecare continand cate 34 telomeri. Telomerii au fost marcati prin hibridizare cu o sonda marcata fluorescent, specifica telomerilor (galben). ADN a fost colorat in rosu pentru a evidentia nucleii. Cei 34 telomeri se intrepatrund intr+un numar mult mai mic de regiuni situate la periferia nucleului.

b)       si c) sunt imagini de microscopie confocala ale celulelor de drojdii marcate prin hibridiyare cu o sonda specifica telomerilor de drojdii (b) si cu anticorp specfic fata de Sir3 marcat fluorescent (c). De retinut ca Sir3 este localizata la nivelul heterocromatinei represate de la nivelul telomerilor. Experimente similare au fost realizate si cu Rip1, Sir2 si Sir4 au demonstrat ca aceste proteine sunt si ele co-localizate cu heterocromatina telomerica.

            Au fost realizate studii genetice cu numeroase gene: RAP1 si 3 SIR (silent Information regulator) care sunt necesare pentru represia locilor silentiosi implicati in conjugare si prezenti la nivelul telomerilor. De exemplu, RAP1 codifica pentru o proteina care se leaga in interiorul          unor secvente de ADN silentiose asociate cu HML si HMR si cu o secventa care este repetata de mai multe ori la nivelul fiecarui telomer al cromozomului de drojdie. Studii biochimice mai recente au demonstrat ca aceste proteine se leaga intre ele si ca impreuna se leaga la capetele terminale ale histonelor H3 si H4. Microscopia confocala in imunofluorescenta asupra celulelor de drojdii marcate cu anticorpi fata de proteinele Sir si Rap si hibridizate cu o sonda ADN care recunoaste regiunea telomerica, evidentiaza ca aceste proteine formeaza structuri multiproteice mari cu localizare telomerica asemanatoare heterocramatinei evidentiate la eucariotele superioare.     

Diapozitiv 70. Model schematic al “silencing” la telomerii de drojdii

Figura: Modelul schematic al mecanismului de “atenuare” (silencing) la nivelul telomerilor de drojdii

            Mai multe copii ale Rap1 se leaga la o secventa repetitiva simpla situata in fiecare regiune telomerica, care este lipsita de nucleozomi (sus). Aceasta determina asamblarea unui complex multiproteic (jos) prin realizarea unor interactii proteina-proteina intre Rap1, Sir2, Sir3 si Sir4 si cozile aminoterminale hipoacetilate ale histonelor H3 si H4 din structura nucleozomilor invecinati. Asterixurile marcheaza prezenta cozilor amino-terminale hiperacetilate ale histonelor. Structura heterocromatinei cuprinde aproximativ 4 kb din secventa ADN situata in vecinatatea situsurilor de legarea ale Rap1 si respectiv a secventei acesteia.

Structura actuala a heterocromatinei inalt organizate nu este inca cunoscuta si inteleasa.



            “silencing” (amortizare, atenuare) la organismele superioare

            Reglarea transcriptiei prin intermediul “represiei mediate de heterocromatina” este foarte importanta la eucariotele superioare. De exemplu, expresia factorilor de transcriptie Hox, care regleaza factorii de transcriptie, care regleaza dezvoltarea “planul corpului” (de exemplu, anatomia normala) la majoritatea animalelor. Mecanismul acestei represii este inca in curs de studiu dar analizele genetice realizate la Drosophila au evidentiat ca multe proteine nucleare sunt implicate in formarea regiunilor de heterocromatina la nivelul unor situsuri specifice din structura genelor Hox. 

Diapozitiv 71. Represorii si activatorii pot orienta deacetilarea histonelor genelor specifice

Rolul deacetilarii histonelor in represia genetica mediata de catre cromatina este sustinut de descoperirea proteinelor de la drojdii care represeaza transcriptia mai multor gene situate in regiuni interne ale cromozomului. Acum se stie ca aceste proteine actioneaza partial determinand deacetilarearegiunilor N-terminaled ale histonelor din structura nucleozomilor care sunt legati la TATA box ale genelor pe care acestea le reprima. Studiile in vitro au femonstrat ca daca secventa de ADN promotor este asamblata intr-un nucleozom cu histone neacetilate, factorii generali de transcriptie nu se pot lega la TATA box si la regiunea de initiere. In histonele neacetilate, lizinele N-terminale sunt incarcate pozitiv si interactioneaza puternic cu gruparile fosfat din structura ADN, crescand afinitatea acestuia fata de suprfata nucleozomului. Prevenind interactia factorilor generali de transcriptie cu regiunea promotor. Din contra legarea factorilor de transcriptie in cazul hiperacetilarii histonelor este mai putin represata fiind din contra sti,mulata de catre activatorii transcriptionali.

            Legatura dintre deacetilarea histonelor si represarea transcriptiei a fost si mai clara cand a fost purificata prima  deacetilaza   histonica din celule umane si ADNc a fost clonat. Aceste deacetilaze au fost gasite ca fiind asociate cu represorii la euacriotele superioare. Acestea includ doi represori heterodimeri care participa la reglarea ciclului celular la mamifere si un grup de receptori nucleari care sunt reglati de catre hormoni liposolubili.

            Studii recente furnizeaza o explicatie pentru observatiile anterioare ca regiunile inactive transcriptional de la vertebrate contin adesea resturi de 5-metil-citidina (mC) urmate imediat de G, in timp regiunile active transcriptional sunt lipsite de mC. S-a determinat ca regiunile care contin mC leaga specific o proteina care la randul ei interactioneaza cu mSin3. Aceste descoperiri sugereaza ca asocierea mSin3 care contine cxmplexe de deacetilaza histonica cu situsurile metilate din structura ADN conduce la deacetilarea histonelor din structura nucleozomilor vecini, facand regiunea inaccesibila la factorii de transcriptie generali si la Pol II, facand-o transcriptional inactiva.

Figura: Rolul deacetilarii si hiperacetilarii cozilor N-terminale ale histonelor in controlul transcriptiei la drojdii.

            a) Deacetilarea dirijata de represor la nivelul cozilor N-terminale ale histonelor. “DNA binding Domain” (DBD) al represorului Ume6 interactioneaza cu un element de control situat in amonte (URS1) ale genelor pe care le regleaza. Domeniul represor al Ume6 (RD) leaga Sin3, o subunitate a unui complex multiproteic care include Rpd3, o deacetilaza histonica. Deacetilarea capetelor terminale ale histonelor din structura nucleozimilor din regiunea de legarea a Ume6 inhiband legarea factorilor generali la TATA box, represand mai degraba expresia genelor.

b) Hiperacetilarea dirijata de catre activatori asupra cozilor N-terminale ale histonelor. Domeniul ADN de legare a Gcn4 interactioneaza cu secventele specifice situate in amonte (UAS) de secventele activatoare ale genelor pe care le regleaza. Domeniul de activare al Ggn4 (AD) interactioneaza apoi cu un complex multiproteic de acetilare a histonelor care include subunitatea catalitica Gcn5. Hiperacetilarea ulterioara a capetelor N-terminale ale histonelor din structura nucleozomilor aflati in vecinatatea situsului de legare a Gcn4 faciliteaza accesul factorilor generali de transcriptie necesari pentru initiere. Represia si activarea unor gene din eucariotele superioare apar prin mecanisme similare.

Diapozitive 72. Analiza starii de acetilare a histonelor in cromatina asociata cu regiuni specifice ale genomului

Figura: Metoda experimentala pentru analiza starii de acetilare a histonelor in cromatina asociata cu o regiune specifica a genomului.

            Nucleozomii sunt slab inretelati cu ADN in vivo folosind un agent de inretelare reversibil permeabil la nivel celular. Este izolata apoi cromatina si scindata pe o lungime medie de trei nucleozomi fiind supusi imunoprecipitarii cu un anticorp specific fasa de o secventa histonica particulara N-terminala specifica. ADN din fragmentul de cromatina imunoprecipitat este eliberat prin reversarea agentului de inretelare si apoi este cuantificat folodin o tehnica PCR sensibila.

Diapozitiv 73. Activatorii stimuleaza stransa cooperare in asamblarea complexelor de initiere

Dupa participarea la hiperacetilarea cromatinei in vecinatatea regiunii promotoare, activatorii transcriptionali se crede ca stimuleaza asamblarea unui complex de initiere si regleaza frecventa cu care noi molecule de Pol II reinitiaza transcriptia. Aceasta functie a activatorilor care furnizeaza un al doilea nivel de control transcriptional, poate fi demonstrat adesea in reactii in vitro, in lipsa histonelor.

            De exemplu, unii activatori stimuleaza legarea TFIID sau legarea simultana a TFIID si TFIIH la TATA box in vitro. Alti activatori interactioneaza cu alti factori generali de transcriptie si cu subunitatile complexului Mediator asociat cu elementele CTD ale subunitatii mari a Pol II.

            Asablamlarea complexului multiproteic de initiere la nivelul promotorului se considera ca este rezultatul unor interactii cooperative multiple. La organismele superioare, cooperativitatea puternica a initierii asamblarii complexelor este partial responsabila pentru expresia genica specifica tipului celular.

            De exemplu, gena TTR care codifica transtiretina de la mamifere care se exprima in hepatocite si in celulele plexului coroid. Transcriptia genei TTR in hepatocite este controlata de cel putin 5 factori transcriptionali diferiti:

            - HNF1, o proteina hepatica specifica homeobox;

            - HNF3, o proteina hepatica specifica “winged-helix”;

            - HNF4, un receptor nuclear care este exprimat si in celulele epiteliale si celulele tubulilor renali;

            - C/EBP, un heterodimer bazic cu elemente Zipper care este exprimat si in celulele epiteliale, celulele grase si in unii neuroni.

            -AP1, o familie mica de proteine bazice zipper care sunt exprimate in toate tipurile celulare.

            Cu toate ca trei dintre acesti activatori sunt exprimati si in alte tipuri celulare., gena TTR nu este transcrisa in aceste celule. Aceasta deoarece intregul set de activatori este prezent numai in hepatocite. Toti activatorii trebuie sa fie prezenti pentru a contribui la asamblarea inalt cooperativa a complexului de initiere a promotorului TTR.

            Diferite gene care codifica proteine hepatice specifice, cum sunt albumina serica sau alfa1-antitripsina, poseda diferite aranjamente ale situsurilor de legare a proteinelor si folosesc seturi de factori comuni dar nu identice. Cu toate acestea nu numai factorii activatori sunt cei care dicteaza proportia si tipul proteinelor care vor fi transcrise (de exemplu albumina este sintetizata in cantitate mult mai mare decat transtiretina) deci mecanismele de reglare aexpresiei sunt mult mai complexe.

Figura: Situsurile de legare ale activatorilor care controleaza transcriptia genei trantiretinei (TTR) din hepatocitele de soarece

            HNF= hepatocyte nuclear factor; EBP=enhancer binding protein; AP1=factor transcriptional heterodimer cjun/cfos

Diapozitiv 74. Modelul asamblarii cooperative a unui complex de initiere activat la nivelul promotorului TTR

Figura: Modelul asamblarii cooperative a complexului de initiere a transcriptiei la nivelul promotorului TTR din hepatocite.

Patru activatori  bine reprezentati in hepatocite plus factorul ubiqitar AP1 se leaga la situsurile specifice de la nivelul “enhancerului” si regiunea proximala promotorului genei TTR. Domeniile de activare ale activatorilor legati interactioneaza extensiv cu co-activatorii. Subunitatile TAF ale TFIID, proteinele Srb/Mediator si factorii generali de transcriptie determina plierea ADN si formarea unui complex activat  stabil de initiere. Datorita naturii inalt cooperativa a procesului de asamblare, complexul de initiere nu se formeaza la nivelul promotorului TTR din celulele epiteliulu intestinal, care contin numai doua din cei patru factori transcriptionali mai bogat reprezentati in ficat. Multi dintre factorii generali de transcriptie, proteinele Srb/Mediator si ARN polimeraza II (Pol II) vor fi pre-asamblate intr-un complex holoenzimatic.  

Diapozitiv 75. Represorii interfera direct cu initierea transcriptiei in mai multe feluri

Figura: Diferitii represori de la eucariote pot inhiba transcriptia prin mecanisme care nu implica deacetilarea histonelor.

In cele trei mecanisme exemplificate mai sus, represorul fie inhiba activarea fie interfera direct cu formarea complexului de initiere. In plus, unii represori interactioneaza cu proteine co-represoare, care se considera ca interactioneaza la randul lor cu factorii generali de transcriptie pentru a inhiba initierea.

            Un represor este orice proteina care interfera cu initierea transcriptiei cand se leaga la un situs specific din structura ADN. Mai sus am aratat ca unii represori pot directiona deacetilarea histonelor prezente in nucleosomii din apropierea situsurilor de recunoastere a acestora. La randul ei deacetilarea histonelor inhiba interactia factorilor generali cu situsurile de legare ADN represand astfel transcriptia. Totusi, studiile care demonstreaza ca anumiti represori sunt capabili sa represeze  transcriptia in vitro, in absenta histonelor indica existenta altor mecanisme de represie directa.

            Desi mecanismele de represie nu sunt foarte bine intelese, unii dintre represori actioneaza conform mecanismelor prezentate mai sus.

Doua dintre mecanisme presupun legarea competitiva dintre represor si activator sau un factor general de transcriptie. In ambele cazuri, legarea unei molecule represoare la un situs ADN specific blocheaza legarea proteinelor necesare initierii transcriptiei. Totusi, in multe cazurirepresorii eucariotici inhiba transcriptia fara a interfera cu legarea unui activator sau a unui factor general de transcriptie. In astfel de cazuri, represorul legat poate interactiona cu un activator din imediata vecinatate, impiedicand functionarea acestuia, sau cu factorii generali legati la promotor impiedicand asamblarea acestora in complexul de initiere.

Diapozitiv 76. Hormonii liposolubili controleaza activitatile receptorilor nucleari

Figura: Exemple de hormoni lipo-solubili care se leaga la membrii superfamiliei receptorilor factorilor de transcriptie. Cortizolul este un hormon care se leaga la receptorul glucocorticoid (GR).

            Asemeni altor hormoni steroizi, acesta este sintetizat din colesterol. Acidul retinoic este un metabolit, derivat de la vitamina A care are efecte puternice asupra dezvoltarii mugurelui limbic la embrioni si in reinnoirea pielii la mamiferele adulte. Ligandul pentru acidul retinoic este RAR (receptorul pentru acid retinoic). Tiroxina este sintetizata din resturi de tirozina in proteina tiroglobulina la nivelul glandei tiroide. Este un ligand pentru receptorul hormonului tiroidian (TR).

           

            Activitatile multor factori de transcriptie sunt reglate de catre hormoni care functioneaza ca semnale extracelulare in organismele multi-celulare. Hormonii sunt secretati de un anumit tip celular si circula prin fluidele extracelulare pentru a actiona asupra functionarii celulelor situate in diferite regiuni ale organismului la distanta considerabila de locul sintezei lor. O clasa de hormoni cuprinde molecule mici, lipo-solubile, care pot difuza prin plasma si membranele nucleare. Asa cum am discutat anterior, acesti hormoni lipodo-solubili, incluzand multi hormoni steroidieni, retinoizi, si hormoni steroidieni, se leaga si regleaza factori de transcriptie specifici apartinand super-familiei de receptori nucleari.

            Domeniul structural al receptorilor nucleari.

            Clonarea si secventializarea genelor care codifica pentru multi receptori nucleari au permis compararea secventei in aminoscizi a acestora. Aceste studii au evidentiat o remarcabila conservare atat a secventei in aminoacizi cat si a diferitelor regiuni functionale  ale diferitilor receptori nucleari. Toti receptorii nucleari poseda o regiune N-terminala de lungime variabila (100-500 aa) continand regiuni care functioneaza ca domenii de activare a transcriptiei. Domeniul de legare la ADN este localizat langa centrul secventei primare si poseda 4 motive C4 “zinc finger”. Domeniul de legare a hormonului este localizat capatul C-terminal al acestor receptori si contine un domeniu de activare hormon-dependent. In unele cazuri domeniul de legare a hormonului functioneaza ca un domeniu represor in absenta ligandului.

Diapozitiv 77. Domeniile structurale ale receptorilor nucleari

Figura: structura generala a factorilor de transcriptie din super-familia receptorilor nucleari

            Domeniul de legare a ADN localizat central manifesta o considerabila omologie de secventa intre diferitii receptori si are un motiv C4 “zinc fingger”. Regiunea C-terminala de legare a hormonului prezinta o omologie mult mai redusa. Regiunile N-terminale ale diferitilor receptori variaza ca lungime, au o secventa unica si pot contine unul sau mai multe domenii de activare. Aceasta configuratie generala a fost determinata pentru receptorul estrogen (553 aa), receptorul pentri progesteron (946 aa), receptorul glucocorticoid (777 aa), receptorul pentru hormonii tiroidieni (408 aa) si receptorul pentru acid retinoic (432 aa).

Diapozitiv 78. “Response elements” sunt secvente de ADN care leaga mai multi receptori nucleari majori

Figura: secvente consens ale situsurilor ADN, numite elemente raspuns, care leaga receptorul glucocorticoid (GRE), receptorul estrogen (ERE), receptorul pentru vitamina D (VDRE), receptorul pentru hormonii tiroidieni (TRE) si pentru acid retinoic (RARE).

            Repetitiile inverse din GRE si ERE si repetitiile directe din VDRE, TRE si RARE sunt indicate prin sageti rosii

           

             Secventele nucleotidice caracteristice ale situsurilor de legare din structura ADN, numite Elemente Raspuns, care leaga numerosi receptori nucleari majori au fost determinate. Secventele consens ale elementelor raspuns la glucorticoizi si estrogeni sunt secvente repetitive inverse de 6 pb separate de oricare trei perechi de baze. Aceste descoperiri sugereaza ca acesti receptori ai hormonilor steroizi se vor lega la ADN sub forma de dimeri simetrici, asa cum s-a demonstrat deja prin cristalografie cu raze X asupra receptorului homodimer al hormonului glucocorticoid.

            Unele elemente raspuns ale receptorilor nucleari, cum sunt cele pentru vitamina D3, hormonii tiroidieni, si receptorii acidului retinoic, sunt secvente repetitive directe ale aceleiasi secvente recunoscute de catre receptorul pentru estrogen, separate de trei la cinci perechi de baze. Receptorii care se leaga la astfel de elemente raspuns direct repetitive ca si heterodimerii care contin un monomer comun receptorilor nucleari numit RXR. De exemplu, elementul raspuns la vitamina D3 este legat de catre heterodimerul RXR-VDR, si elementul raspuns la acidul retinoic este legat de catre RXR-RAR. Monomerii care compun acesti heterodimeri interactioneaza unii cu altii intr-un mod care face ca cele doua domenii de legare la ADN sa se lege la fel dar intr-o orientare inversa, permitand heterodimerilor RXR sa se lege la repetitiile directe ale situsului de legare pentru fiecare monomer. In contrast, monomerii receptorilor nucleari homodimeri (ex, GRE si ERE) au o orientare inversa.  

Din cursul anterior

Receptorii steroidieni poseda domenii pentru legarea ADN, legarea hormonilor si activarea transcriptiei

            Hormonii steroizi sunt sintetizati ca raspuns la o varietate de activitati neuroendocrine, si exercita efecte majore asupra cresterii, dezvoltarii tesuturilor si homeostaziei corpului in lumea animala. Grupul major de steroizi si alti cativa compusi cu activitati (moleculare) inrudite sunt clasificate in figura 30.10 (Genes V).

            Glandele adrenale secreta peste 30 de steroizi, cele doua grupuri majore fiind glucocorticoizii si mineralocorticoizii. In categoria steroizilor intra hormonii reproducatori (hormonii de sex masculin si hormonii de sex feminin). Vitamina D este necesara pentru o buna dezvoltare a oaselor.

            Alti hormoni cu structuri si functii neinrudite pot actiona la nivel molecular in mod similar hormonilor steroidieni. Hormonii steroizi si tiroidieni pot avea si ei un rol important in metamorfoza (steroizii insectelor si hormonii tiroidieni de la broaste).

            Acidul retinoic (vitamina A) este o substanta morfogena responsabila de dezvoltarea axei antero-posterioare in timpul dezvoltarii mugurelui membrelor la pui. Metabolitul sau , acidul-9-cis retinoic se gaseste in tesuturi care sunt situsuri majore de stocare si de metabolizare a vitaminei A.

            Pe langa aceste diferite actiuni  care presupun reglarea dezvoltarii corpului trebuie sa mai adaugam si functiile de reglare a cailor de expresie genica. Acesti compusi diferiti manifesta un mod de actiune comun: fiecare reprezinta o molecula mica care se leaga la un receptor specific care activeaza transcriptia genelor. (Receptorul poate sa nu fie nominalizat: proteina este un receptor pentru un hormon steroid sau tiroidian in acelasi sens in care represorul lac este receptor pentru b-galactozid: nu este un receptor in sensul de proteina legata de membrana (membranara) care este expusa la suprafata celulelor).

            Despre interactiunea glucocorticoizilor cu receptorul lor se cunoaste mai mult. Actiunea este ilustrata in figura 30.11. Un hormon steroid poate strabate membrana celulara pentru a intra in celula prin simpla difuzie. In interiorul celulei, glucocorticoidul se leaga la receptorul glucocorticoid. (Studiile pe receptorul glucocorticoid au fost realizate cu hormonul steroid sintetic, dexametazona). Localizarea receptorilor liberi nu este pe deplin clarificata; ei pot fi in echilibru intre nucleu si citoplasma. Dar cand hormonul se leaga la receptor, proteina este transformata intr-o forma activata cu o afinitate de 10x mai mare pentru ADN ne-specific; complexul hormon-receptor este totdeauna localizat in nucleu.

            Receptorul activat recunoaste a secventa consens specifica care identifica GRE, elementul raspuns la glucocorticoid. GRE este localizat tipic la nivelul unui activator situat in vecinatatea generala a unei gene care raspunde la actiunea glucocoiticoizilor. Secventa GRE poate fi pozitionata la mai multe kilobaze in amont sau in aval de promotor. Cand complexul steroid-receptor se leaga la activator, este activat promotorul din vecinatate (corespunzator) iar transcriptia este initiata. Activarea ‘activatorului’ furnizeaza mecanismul general prin care steroizii regleaza un set larg de gene tinta. Actiunea corespunde formal modelului bacterian de inducere a reglarii pozitive de catre un reglator pozitiv (co-inductorul activeaza inductorul proteinei).

            Prin clonarea ADNc care codifica receptorii hormonilor steroizi, au fost deduse structurile proteinelor corespunzatoare. Introducerea ADNc, care codifica pentru un receptor, intr-o celula confera, in continuare, acelei celule capacitatea de a raspunde la steroid prin activarea oricarei gene corelata cu unul dintre elementele raspuns. Acest sistem poate fi folosit pentru a analiza proprietatile receptorilor codificati de catre ADNc in care au fost introduse mutatii. Astfel de analize au condus impartirea receptorilor in regiunile prezentate in figura 30.12 (Genes V).

            Receptorii diferitelor grupe de hormoni steroizi, hormoni tiroidieni, si acid retinoic reprezinta o ’ noua super-familie’ de gene reglatoare, factori de transcriptie care raspund la liganzi (ligand-responsive transcription factors).

            Toti receptorii prezinta domenii independente de legare a ADN si a hormonilor.

            Pentru diferitii receptori steroizi domeniile centrale de legare a ADN sunt bine corelate iar pentru alti receptori raman identificabile. Anumiti liganzi poseda receptori multipli care sunt strans corelati, cum este cazul celor trei receptori ai acidului retinoic ( a, b si g) si a celor trei receptori ai acidului 9-cis -retinoic (RXRa, b, g). Conversarea secventei reflecta probabil cerintele comune de legare la ADN, in timp ce variatia este responsabila pentru selectionarea diferitelor secvente tinta. Actul (procesul) de legare a ADN nu poate fi deconectat de capacitatea de activare a transcriptiei, deoarece mutatiile prezente in acest domeniu afecteaza ambele activitati.

            Regiunile N-terminale ale receptorilor arata secventa minima conservata. Ele includ alte regiuni necesare activarii transcriptiei.

            Domeniile C-terminale leaga hormonii. Cele din familia receptorilor steroizi prezinta o inrudire de 30 la 57%, reflectand specificitatea pentru hormonii individuali. Relatiile cu alti receptori sunt minime, reflectand specificitatea pentru o varietate de compusi: hormoni tiroidieni, vitamina D, acid retinoic, etc.

            Regiunea C-terminala regleaza activitatea receptorului, diferit pentru fiecare tip de receptor individual in parte. Daca domeniul C-terminal al receptorului glucocorticoid este eliminat, proteina N-terminala ramasa este constitutiv activa: aceasta nu mai necesita steroizi pentru activare (pentru activitate). Aceasta sugereaza ca, in absenta steroidului, domeniul de legare a steroidului impiedica receptorul sa recunoasca secventa GRE; acesta functioneaza ca reglator negativ intern. Adaugarea hormonului steroid inactiveaza inhibitia, dand posibilitatea receptorului sa se lege la secventa GRE si sa activeze transcriptia. Baza represiei poate fi interna, corelata cu interactiunile cu o alta parte a receptorului. O alta ipoteza este ca represia poate fi si rezultatul interactiunilor cu alte proteine, care sunt eliberate (deplasate) cand se leaga steroidul.

            Interactia dintre domenii este diferita in cazul receptorului pentru estrogeni. Daca domeniul de legare a hormonului este inlaturat, proteina este incapabila sa activeze transcriptia, chiar daca continua sa se lege la secventa ERE. Deci, aceasta regiune este mai degraba necesara sa activeze decat sa reprime activitatea.

            Fiecare receptor recunoaste ‘elementele raspuns’ care sunt inrudite cu o secventa consens. Asa cum este prezentat in tabelul 30.1, aceste ‘elemente raspuns’ au o trasatura caracteristica: fiecare consens consta in doua secvente repetitive scurte (or half sites=jumatati de situs). Aceasta structura sugereaza imediat ca legarea receptorului se face sub forma multimerica, astfel incat fiecare jumatate a secventei consens este contactata de catre o subunitate (reminescente ale interactiei operatorului si represorului fagului l).

            ‘Elementele raspuns’ ale diferitilor receptori pot fi palindroame sau repetitii directe in care jumatatile de situs sunt separate de 0-4 pb a caror secventa este irelevanta (neinsemnata). Numai doua dintre aceste jumatati de situs sunt folosite de diferiti receptori. Orientarea lor si distanta dintre ele determina tipul de receptor (receptorul) care va recunoaste ‘elementul raspuns’. Acest comportament permite ‘elementelor raspuns’, care au secvente consens limitate (restranse) sa fie recunoscute specific de o varietate de receptori. Regulile care guverneaza recunoasterea nu sunt absolute, dar pot fi modificate de context, si exista si cazuri in care ‘elementele raspuns’ palindromice (cu structura de palindrom) sunt recunoscute permisiv de mai mult decat un receptor.

            Receptorii se impart in doua grupe:

            1) Receptorii glucocorticoizi (GR), mineralocorticoizi (MR), androgen (AR) si progesteron (PR) sunt toti homodimeri. Ei recunosc ‘elementele raspuns’ ale caror jumatati de situs au o secventa consens TGTTCT. Jumatatile de situs sunt aranjate sub forma de palindroame, iar distanta dintre situsuri determina tipul de element. Receptorul pentru estrogen (ER) functioneaza intr-un mod asemanator dar are ca jumatate de situs secventa TGACCT.

2)  Receptorii tiroidieni (T3R), pentru vitamina D (VDR), pentru acid retinoic (RAR) si

pentru acid -9-cis-retinoic (RXR) formeaza heterodimeri, care recunosc ‘jumatati de elemente’ a caror secventa este TGACCT. Jumatatile de situs sunt aranjate ca unitati repetitive directe, recunoasterea lor fiind influentata de separarea lor dupa cum urmeaza:

            1 pb® RXR

            3 pb® VDR

            4 pb® T3R

            5 pb® RAR

Acest mod de recunoastere caracteristic celui de al doilea grup este valabil pentru

receptorii dimeri a caror prima subunitate este receptorul de pe lista, si cea de a doua este formata din RXR (in concluzie prima pozitie de pe lista este un homodimer). Necesitatile formarii unui heterodimer au fost descoperite deoarece receptorii pentru acid retinoic si hormoni tiroidieni (RARs si TRs) se leaga mult mai eficient la situsurile tinta in prezenta unui factor aditional, care se pare ca este reprezentat de RXR. Receptorul heterodimer raspunde ligandului prin intermediul primei subunitati, si aparent nu necesita RXR pentru a cupla (lega) ligandul. Acesti receptori pot forma si homodimeri care recunosc secventele palindromice.

            Acum suntem in situatia de a putea intelege bazele specificitatii de recunoastere. In figura 30.9 este redat modul in care se realizeaza recunoasterea secventei unei jumatati de situs prin intermediul secventei de aminoacizi caracteristica primului deget. Specificitatea de formare a dimerului este data de secventa in aminoacizi a celui de al doilea deget. Se pare ca formarea dimerilor determina probabil distanta dintre subunitatile care sunt pozitionate in curburile succesive ale fosei majore, controland astfel raspunsul la distanta dintre jumatatile de situs.

 

Diapozitiv 79. Translocarea “hormon-dependenta” a receptorilor homodimeri

Figure: Demonstratie experimentala ca domeniul de legare a hormonului al receptorului glucocorticiod (GR) mediaza translocarea catre nucleu in prezenta hormonului.

            Celule animale in cultura au fost transfectate cu vectori de expresie care codifica proteinele prezentate in partea de jos a imaginii. Marcarea imunofluorescenta a fost obtinuta cu un anticorp specific pentru beta-galactozidaza si folosit pentru a detecta proteinele exprimate in celulele transfectate.

a)      Cand celulele au fost transfectate numai cu beta-galactozidaza enzima exprimata a fost localizata in citoplasma in prezenta si in absenta hormonului glucocorticoid dexametazona (Dex);

b)       Cand o proteina de fuziune constand din beta-galactozidaza si intregul receptor glucocorticoid de soarece de 974 aa (GR) a fost exprimata in celulele in cultura, a fost prezenta in citoplasma in absenta hormonului dar a fost transportata in nucleu in prezenta hormonului.

c)       O proteina de fuziune compusa dintr-o regiune de 382 aa a GR incluzand domeniul de legare a ligandului (portocaliu) si beta-galactozidaza prezinta,  de semenea, un transport catre nucleu dependent de hormon.

            Mecanismul de control hormonal al activitatii receptorilor nucleari

            Legarea hormonilor la receptorul nuclear regleaza activitatea acestuia ca factor de transcriptie. Aceasta reglare difera sub unele aspecte intre receptorii nucleari heterodimeri si cei homodimeri.

            Cand receptorii nucleari heterodimeri (ex. RXR-VDR, RXR-TR si RXR-RAR) sunt legati la situsurile lor de recunoastere din structura ADN, ei actioneaza ca represori sau activatori ai procesului transcriptional depinzand de tipul de hormon care ocupa situsul de legare a ligandului. In absenta hormonului, acedsti receptori nucleari directioneaza deacetilarea histonelor de la nivelul nucleozomilor situati in vecinatate. In prezenta hormonului, domeniul de legare a hormonului sufera o modificare conformationala drastica. Acesti receptori nucleari pot dirija hiperacetilarea histonelor nucleosomilor vecini, reversand in felul acesta efectele represoare ale domeniului de legare fara hormon. Domeniul N-terminal de activare al acestor receptori nucleari reactioneaza probabil apoi cu factori aditionali, stimuland asamblarea cooperativa a complexului de initiere.

            In contrast cu receptorii nucleari heterodimeri, care sunt localizati exclusiv in nucleu, receptorii homodimeri se gasesc atat in citoplasma cat si in nucleu, iar activitatea lor este reglata prin controlul transportului lor din citoplasma in nucleu. Translocarea hormon-dependenta a receptorului homodimer glucocorticoid (GR) a fost demonstrata prin experiente de transfectie conform figurii de mai sus. Domeniul de legare a hormonului glucocorticoid (GR) singur mediaza acest transport.  

            Studii ulterioare au aratat ca in absenta hormonului, receptorul glucocorticoid este ancorat in citoplasma ca un agregat proteic mare complexat cu proteine inhibitoare incluzand Hsp90, o proteina inrudita cu Hsp70, proteina heat-choc cea mai mare. In aceasta situatie, receptorul nu poate reactiona cu genele tinta; deci, nu apare activare transcriptionala. Legarea hormonului elibereaza receptorul glucocorticoid de ancora sa citoplasmatica, permitand acestuia sa intre in nucleu el se va lega la elementele raspuns asociate genelor tinta. O data ce receptorul la care este legat hormonul interactioneaza cu elementul raspuns, el activeaza transcriptia prin determinarea hiperacetilarii histonelor si facilitarea asamblarii cooperative a complexului de initiere.

            Receptorii orfelini

             Liganzii pentru domeniile de legare a hormonilor ai multor membrii ai super-familiei de receptori nucleari sunt inca necunoscuti. De exemplu, HNF4, care este implicat in expresia genei transtireninei in hepatocite. Majoritatea acestor proteine de legare la ADN sunt denumite “receptori orfani/orfelini”, au fost descoperite prin “screening-ul” bancilor de ADNc cu sonde specifice pentru secventele nucleotidice inalt conservate ale domeniilor de legare a ADN ale receptorilor nucleari. Rolul precis al receptorilor orfelini si identificarea hormonilor necunoscuti care se presupun ca regleaza activitatea acestora sunt inca subiecte importante de cercetare.

Diapozitiv 80. Model de activarea “hormon-dependenta” a genelor de catre receptorul glucocorticoid

Figura: Modelul de activare homon-dependenta a genelor activate de catre receptorul glucocorticoid (GR).

            In absenta hormonului, GR este legat intr-un complex cu Hsp90 in citoplasma via domeniului sau de legare  (portocaliu). Cand hormonul este prezent, el difuzeaza prin membrana plasmatica si se leaga la domeniul de legare GR, determinand modificari conformationale in domeniul de legare a ligandului care elibereaza receptorul de Hsp90. Receptorul cu ligandul legat este apoi translocat in nucleu unde domeniul sau de legare la ADN (portocaliu deschis) se leaga la elementele raspuns, permitand domeniului de activare (verde) sa stimuleze transcriptia genelor tinta.

           

Diapozitiv 81. Hormonii polipeptidici semnalizeaza fosforilarea unor factori de transcriptie

Figura: Modelul de activare genica a IFNgama prin fosforilarea si dimerizarea Stat1alfa.

            JAK kinaza este activata cand receptorul IFNgama dimerizeaza prin legarea la IFNgama. Kinaza JAK activata fosforileaza un rest specific de tirozina din monomerii Start1alfa in citoplasma. Stat1alfa fosforilata dimerizeaza, si dimerul fosforilat transloca apoi in nucleu unde el se leaga elementele raspuns corespunzatoare, promovand transcriptia genelor reglate de catre IFNgama.

            Hormonii polipeptidici semnalizeaza fosforilarea unor factori de transcriptie

            Desi hormonii lipo-solubili pot difuza prin membrana plasmatica si interactioneaza direct cu factorii de transcriptie din citoplasma sau nucleu, cea de a doua clasa majora de hormoni, peptidici si proteici, nu poate. In schimb, acesti hormoni functioneaza prin legarea la receptori specifici de pe suprafata celulara, care apoi transmit semnalul ca au legat hormonul la proteinele din interiorul celulei, un proces numit “transducerea semnalului”.

            In multe cazuri, mecanismul prin care un semnal hormonal este transdus intr-un semnal de activare pentru factorii de transcriptie implica fosforilarea. Un exemplu simplu este furnizat de catre interferonul gama (IFNgama), un hormon eliberat de catre limfocitele T-helper stimulate antigenic, care sunt critice in raspunsul imun. Cand IFNgama se leaga la proteina receptoare specifica care este prezenta la suprafata majoritatii celulelor, acesta induce expresia unui numar de gene, producand o stare antivirala care scade susceptibilitatea celulelor la infectiile determinate de o serie de virusuri. INFgama stimuleaza functionarea altor celule care participa la raspunsul imun. Pentru a analiza cum acest hormon determina inductia unui set specific de gene, cercetatorii au identificat mai intai elementul raspuns la la IFNgama si apoi au purificat o proteina din nucleii celulelor tratate cu IFNgama care se leaga la aceasta secventa. Proteina izolata are aproximativ 91 kDa si este numita Stat1alfa, pentru signal transductor si activator al transcriptiei.

            Dupa ce celulele in cultura au fost tratate cu IFNgama, activitatea de legare la ADN a Start1alfa creste rapid, in paralel cu cresterea transcriptiei genelor inductibile. Aceasta inducere a activitatii de legare a Stat1alfa apare chiar si in tratate cu un inhibitor al sintezei proteice, indicand ca unele tipuri de modificari post-translationale ale proteinei pre-existente Stat1alfa activeaza activitatea sa de legare la ADN. Prin marcarea (colorarea) celulelor cu anticorpi anti-Stat1alfa marcati fluorescent, cercetatorii demonstreaza ca Stat1alfa transloca din citosol in nucleu in urma tratamentului cu IFNalfa, cu cinetici similare cu cele ale inducerii genelor.

Analizele proteinei Stat1alfa din celulele tratate cu IFNgama demonstreaza ca tratamentul hormonal conduce la fosforilarea unui rest specific de tirozina din structura proteinei. Mai mult, proteina fosforilata Stat1alfa formeaza homodimeri in timp ce proteina nefosforilata este un monomer. Cand restul critic de tirozina a fost schimbat cu o fenilalanina prin mutageneza dirijata situs-dirijata, proteina mutanta Stat1alfa nu mai activeaza genele tinta intr-un experiment de transfectie, si opreste translocarea in nucleu.

            Modelul descris este prezentat in figura.

            Fosforilarea unor resturi specifice de serina si de treonina regleaza de asemenea activitatea unui numar mare de factori de transcriptie. Diferitele cai de transducere a semnalului care regleaza factorii de transcriptie vor fi prezentate mai tarziu (capitolul 20).

            In unele cazuri (de exemplu Stat1alfa), fosforilarea factorilor de transcriptie liberi moduleaza activitatea sa de legare la ADN. In alte cazuri, (ex, CREB), factorii de transcriptie inactivi, monofosforilati se leaga la secventele de recunoastere din structura ADN; fosforilarea modifica apoi functionarea domeniului de activare, astfel incat proteina poate stimula transcriptia.     

Diapozitiv 82. Concluzii

Controlul transcriptional la eucariote opereaza pe trei nivele: i) modularea nivelelor si/sau activitatilor activatorilor si represorilor; ii) modificari in structura cromatinei determinate de activatori si represori; iii) influenta directa a activatorilor si represorilor in asamblarea complexelor de initiere;

            Heterocromatina se refera la regiunile de cromatina condensata in care ADN este relativ inaccesibil factorilor de transcriptie si altor proteine, astfel incat expresia genei este represata;

            Represarea mediata a heterocromatinei apare la nivelul telomerilor si a locilor implicati in conjugare la S. Cerevisiae. Interactiile diferitelor proteine si hipoacetilarea regiunilor N-terminale ale histonelor H3 si H4 sunt responsabile pentru represarea structurii cromatinei in aceste regiuni;

            Unii represori functioneaza partial prin interactia cu complexele de deacetilare a histonelor, avand drept rezultat deacetilarea histonelor din structura nucleosomilor situati in vecinatate. Aceasta inhiba interactia dintre promotorul ADN si factorii generali de transcriptie, represand astfel initierea transcriptiei;

            Unii activatori functioneaza partial prin interactia cu complexele de deacetilare a histonelor, avand drept rezultat deacetilarea histonelor din structura nucleosomilor situati in vecinatate. Aceasta faciliteaza interactia dintre promotorul ADN si factorii generali de transcriptie, activand initierea transcriptiei;

Diapozitiv 83. Concluzii

Factorii care remodeleaza cromatina determina disocierea tranzitorie a ADN de “miezul” histonic printr-o reactie ATP-dependenta si promoveaza astfel legarea altor proteine necesare procesului de initiere care se desfasoara la nivelul anumitor promotori ADN; 

            In vitro, combinarea activatorilor poate stimula asamblarea complexelor de initiere din vecinatatea promotorului. Se crede ca acest efect direct al activatorilor apare in vivo in urma acetilarii histonelor;      

            In vivo, asamblarea “inalt” cooperativa a complexului de initiere necesita mai multi activatori. O celula trebuie sa produca un set specific de activatori necesari pentru transcriptia unei anumite gene in scopul reglarii expresiei acesteia;

            Unii represori inhiba competitiv legarea activatorilor sau factorilor generali de transcriptie. Altii interactioneaza direct cu factorii generali sau cu activatorii;

            Activitatile super-familiei recptorilor nucleari sunt reglate de hormonii lipo-solubili. Legarea hormonilor la acesti factori de transcriptie induce modificari conformationale care modifica interactiile lor cu alte proteine;

            Activitatile unor factori de transcriptie sunt reglate prin fosforilare indusa de legarea hormonilor polipeptidici la receptorii lor situati la suprafata celulelor.

Diapozitiv 84. Transcriptia initiatiata de Pol I si Pol III este analoga celei realizata de Pol II

In continuare vom discuta procesul de initiera a transcriptiei realizat de alte ARN polimeraze.

Totusi, aceste sisteme, in particular reglarea acestora, sunt mult mai putin cunoscute decat sistemele de transcriptie de la E.coli. Si cele patronate de ARN polimeraza II.

            Initierea transcriptiei realizata de Pol I si de Poli III este anologa cu cea de la Pol II.

 Sa ne reamintim ca ARN polimeraza I (Pol I) este dedicata sintezei pre-ARNr, iar ARN polimeraza III (Pol III) transcrie genele ARNt , genele ARNr 5S si genele care codifica multe alte molecule de ARN mici. Formarea complexelor de initiere a transcriptiei care implica Pol I si Pol III este similara in unele privinte cu asamblarea realizata in cazul Pol II. Totusi, fiecare din cele trei ARN polimeraze eucariote nucleare necesita factori generali de transcriptie specifici (sau de initiere) care recunosc diferite elemnete de control diferite. Pe de alta parte nici Pol I si nici Pol III nu necesita hidroliza ATP pentru a initia transcriptia, in timp ce Pol II da.

            Initierea de catre Pol I. Genele umane pentru pre-ARNr prezinta doua regiuni de control: un element core, care include situsul de start si care este esential pentru transcriptie, este un UCE (upstream control element) de aproximativ 50 pb, care incepe la aproximativ 100 pb fata de situsul de start, si care stimuleaza transcriptia in vitro de aproximativ 10 la 100 ori. Doua proteine de legare la ADN asista Pol I pentru a initia si transcrie corect genele pre-ARNr. Primul dintre ele este factorul de laegare din amonte UBF (upstream bin ding factor), care se leaga atat la UNC cat si la portiunea din amonte a elementului core, chiar daca se considera ca acestea au in aparenta o secventa putin similara. Factorul de selectivitate I (SL1), o proteina multimera  se leaga si stabbilizeaza astfel complexul. Dupa legarea subunitatilor SL1, Pol I se leaga si initiaza transcriptia. Una dintre subunitatile SL1 este TBP, aceeasi proteina cu cea care joaca rolul central in initierea Pol II.

            Initierea de catre Pol III. Spre deosebire de genele care codifica pentru proteine si pre-ARNr, regiunile promotoare ale genelor pentru ARNt si ARNr 5S sunt in intregime in interiorul secventei transcrise. Doua astfel de elemente promotoare interne, numite box A si box B sunt prezente in toate genele pentru ARNt. Aceste sevente inalt conservate nu functioaneaza numai ca promotori dar codifica si doua portiuni ale moleculelor de ARNt eucariot care sunt necesare sintezei de proteine. La nivelul genelor ARNr 5S se afla numai o regiune de control interna numita cutia C, care actioneaza ca un promotor.

            Factorii generali de transcriptie necesari lui Pol III pentru a initia transcriptia genelor pentru ARNt si ARNr 5S au fost bine caracterizate la S. Cerevisiae. Doi factori multimeri, THIIIC si TFIIIB participa atat la initierea ARNt si ARNr 5S la drojdii. Asamblarea complexului de initiere ale genelor ARNt incep prin legarea singulara a TFIIIC la cutia A si cutia B. Interactia factorului TFIIIC cu TFIIIB il directioneaza pe acesta din urma sa se lege la secventele de aproximativ 30 pb situate in amonte de situsul de start al transcriptiei. Asamblarea complexului de initiere al genelor pentru ARNr 5S incepe cu legarea celui de al treilea factor, TFIIIA si cutia C. Apoi TFIIIC se leaga la TFIIIA si este pozitionat prin intermediul interactiilor proteina-proteina intr-o pozitie similara fata de situsul de start ca si in cazul legarii TFIIIC la genele pentru ARNt. TFIIIB interactioneaza analog cu TFIIIC si se leaga apoi la o secventa ADN situata la aproximativ –30 pb, asemeni legarii la gena ARNt.

            Jumatatea N-terminala a uneia dintre subunitatile TFIIIB, numita BRF (pentru TFIIB related factor), este similara cu secventa TFIIB (un factor al Pol II). Similaritatile sugereaza ca BRF si TFIIB realizeaza o functie similara in initiere, adica directionarea polimerazei la situsul corect de start. O data ce TFIIIB se leaga atat la genele pentru ARNt cit si pentru ARNr 5S, Pol III se poate lega si initia transcriptia in prezenta ribonucleotidtrifosfatilor Subunitatea BRF a TFIIIB interactioneaza specific cu una dintre subunitatile polimerazice unice pentru Pol III, aceasta fiind elementul specific important  pentru initierea procesului de transcriptie de catre Pol III. Dupa legarea TFIIIB, TFIIIC poate fi inlaturat fara a afecta initierea realizata de catre Pol III. Astfel, TFIIIC se poate considera ca ca fiind un factor de asamblare critic legarea factorului de initiere TFIIIB.

            O alta subunitate din cele trei care compun TFIIIB si TBP, care este o componenta a a factorului general de transcriptie comun pentru toate cele trei ARN polimeraze nucleare. Aceste descoperiri ca TBP participa in initierea transcriptiei atat cu Pol I cat si cu Pol III au fost surprinzatoare, deoarece promotorii recunoscuti de aceasta proteina nu contin TATA box. Pe de alta parte, studii recente indica ca TBP ca subunitate a TFIIIB interactioneaza cu ADN similar cu interactia cu TATA box.     

Diapozitiv 85. Alte sisteme de transcriptie

Ø      T7 si alti bacteriofagi inruditi exprima ARN polimeraze monomere

Ø      ADN mitocondrial este transcris de catre ARN polimeraze care prezinta similaritati cu enzimele bacteriofagilor sau bacteriene

Ø      Transcriptia ADN din cloroplaste se aseamana cu transcriptia bacteriana

Ø      Transcriptia de la archaea este mai apropiata de transcriptia de la eucariote decat de cea de la bacterii

T7 si alti bacteriofagi inruditi exprima ARN polimeraze monomere

Bacteriofagul T7 domina complet sinteza macromoleculelor in gazdele sale de E. Coli timp de cateva minute dupa transfectie. Toti ribozomii celulei realizeaza sinteza exclusiva a proteinelor codificate de virus. Virusul realizeaza acest lucru prin directionarea initiala a sintezei ARN polimerazei codificata de virus, care nu recunoaste promotorii E. Coli ci un set de promotori care inactiveaza ARN polimeraza de la E.coli. In consecinta cand ARN polimeraza gazdei este inactivata, transcriptia genomului gazda se opreste; deoarece ARNm de la E. Coli au o durata de viata foarte scazuta, sinteza marii majoritati a proteinelor de la E. Coli inceteaza curand. T7 ARN polimeraza initiaza transcriptia de la promotori care se suprapun cu situsrile de start din ADN viral. Secventa de 23 pb a promotorului T7 este complet diferita de promotorii de la E. Coli.

            T7 ARN polimeraza, un singur lant polipeptidic de 98 kDa, este cea mai simpla ARN polimeraza cunoscuta. Enzima este probabil cea mai simpla posibil molecula proteica capabila sa realizeze functiile unei ARN polimeraze: legarea specifica la promotori, initierea, elongarea si terminarea. Deoarece virusul este orientat sa sintetizeze proteinele care formeaza capsula virionului la un nivel maxim, T7 ARN polimeraza nu este reglata semnificativ. O astfel de ARN polimeraza foarte activa si nereglata cum este T7 ARN polimeraza si cum sunt polimerazele bacteriofagilor inruditi T3 si SP6 sunt foarte utile sintezei ARN in vitro si expresiei sistemelor bacteriene.

     ADN mitocondrial este transcris de catre ARN polimeraze care prezinta similaritati cu enzimele bacteriofagilor sau bacteriene

            Mitocondria contine un genom ADN distinct si un sistem de sinteza proteica in interiorul membranei mitocondriale interne, in compartimentul cunoscut sub numele de matrixul mitocondrial. Acest ADN codifica un subset de proteine esential pentru principalelor functii: sinteza ATP prin fosforilare oxidativa. ADNmt este transcris de catre ARN polimeraze care sunt codificate de catre ADN nuclear. Acestea sunt mult mai simple decat cele trei ASRN polimeraze eucariote care transcriu ADN nuclear si chiar de catre polimerazelor sistemelor bacteriene actuale.

            ARN polimeraza mitocondriala de la S. Cerevisiae consta intr-o subunitate polipeptidica de 145 kDa cu activitate polimerazica si un factor specific de 43 kDa esential pentru initierea transcriptiei la situsurile de start ADNmt. ARN polimeraza mitocondriala purificata de la Xenppus laevis are os tructura similara. Subunitatea mare a ARN polimrerazei mitocondriale de la drojdii este clar inrudita cu ARN polimeraza monomera din a bacteriofagului T7 si din bacteriofagii similari. Totusi, enzima mitocondriala este distincta functional de enzima din bacteriofagi in ceea ce priveste dependenta sa de subunitatea mica pentru a initia transcriptia de al nivelul situsului de start.  Aceasta subunitate mica este inrudita cu factorii sigma  ai ARN polimerazelor bacteriene care interactioneaza cu promotorul ADN. Astfel, ARN polimerazele mitocondriale se pare ca sunt structuri hibride intre ARN polimeraza simpla a bacteriofagilor si ARN polimeraza bacteriana posedand o complexitate intermediara.

            Similar cu ARN polimeraza din bacteriofagi, secventele promotor recunoscute de catre ARN polimerazele mitocondriale includ situsul de start, o secventa promotoare bogata in Acare a fost bine caracterizata la drojdii, plante si animale. Genomul mitocondrial uman, circular contine doua secvente promotoare inrudite de 15 pb, cate una pentru transcriptia fiedcarei catene. Fiecare catena este transcrisa in integritatea sa; primul transcript primer lungeste apoi procesat la molecule de ARNm, ARNr si ARNt. O proteina bazica de 22 kDa numita mtTF1, care se leaga imediat in amonte de cei doi promotori mitocondriali, stimuleaza foarte mult transcriptia. O proteina omologa gasita in mitocondriile de drojdie este necesara pentru mentinerea ADMmt si are probabil o functie similara.    

            Transcriptia ADN din cloroplaste se aseamana cu transcriptia bacteriana

            ADN circular existent in cloroplaste este considerabil mai mare decat ADNmt, variind intre 120 la 160 kpb la diferite plante. ARN polimeraza care transcrie ADN din cloroplasteeste codificata de catre acest genom. Enzima prezinta subunitati care au o omologie considerabila cu subunitatile alfa, beta si gama ale ARN polimerazei de la E. Coli, dar aparent lipseste subunitatea echivalenta factorului sigma de la E. Coli.

            Unii promotori de la cloroplaste prezinta reminescente ale promotorului reconoscut de subunitatea sigma de la E. Coli, avand secvente similare in regiunile –10 si –35. Totusi, transcriptia unor promotori depind de secvente situate in regiunile –20 la +60, foarte diferiti de majoritatea promotorilor de la E. Coli. Acest promotor poate fi recunoscut de o a doua ARN polimeraza care este cel mai adesea codificata de genomul nuclear si important in organit. Analizele transcriptiei din cloroplaste sunt destul de putin dezvoltate, dar in acest moment este clar ca cel putin un sistem de transcriptie prezinta o omologie ridicata cu transcriptia de la E. Coli si de la alte bacterii.

            Transcriptia de la archaea este mai apropiata de transcriptia de la eucariote decat de cea de la bacterii

            Archeobacterii constituie cea de a treia ramura in evolutia oranismelor, alaturi de bacterii si eucariote. Analize genomice recente sugereaza puternic ca evolutia ramurii bacteriilor din stramasul comun inainte de despartirea archeobacteriilor si eucariotelor dovedeste ca archeobacteriile sunt mult mai apropiate de eucariote decat bacteriile.

            Ca si bacteriile, archeobacteriile au o singura ARN polimeraza, dar aceasta contine 13 subunitati distincte (chiar 14 la unele), o complexitate echivalenta cu cea a ARN polimerazelor eucariote. Secventa de aminoacizi dedusa pentru 7 subunitati arata o semnificativa omologie cu subunitptile eucariote, incluzand pe cele doua mai mari, care sunt comune la toate trei ARN polimerazele nucleare. Totusi, unele dintre subunitatile de la archeobacterii manifesta o similaritate scazuta cu alte secvente ale subunitatilor de la bacterii sau de la eucariote.

            Desi archoebacteriile, ca si bacteriile, transcriu operoni in ARNm policistronic, promotorii archeo sunt similari cu promotorii de la eucariote.  O secventa promotoare consens bogata in A/T este pozitionata la 26 pb in amonte fata de situsul de start de la acrheobacterii.  Cvasi promotorii TATA box de la eucariote, insertiile si deletiile din apropierea acestei secvente conduc la o pierdere a situsului de start pentru mentinerea spatiului din amonte fata de promotor. In plus, archeobacteriile contin factori de initiere cu o omologie inalta cu TBP si TFIIB. In consecinta, mecanismul initierii transcriptiei la archeobacterii este probabil similar cu cel de la eucariote. In concluzie, se cunoaste putin privind modul in care este reglata transcriptia la acest grup fascinant de organisme.   

Diapozitiv 86. Concluzii

Initierea transcriptiei de catre Pol I este dirijata de catre un element promotor “core”, care se suprapune cu situsul de start, si o regiune de control situata in amonte (UCE). Aceata necesita doi factori de transcriptie generali, SL1 si UBF;

            Initierea transcriptiei de catre ARN polimeraza III este cel mai adesea dirijata de catre elemente promotoare interne. Doi factori generali de transcriptie sunt necesari pentru initierea transcriptiei ARNt (TFIIIC si TFIIIB); un factor suplimentar (TFIIIA) este necesar pentru initierea transcriptiei genelor ARNr 5S;

            Initierea transcriptiei de catre toate cele trei ARN polimeraze nucleare eucariote necesita un factor de transcriptie specific general care contine TBP ca subunitate;

            Initierea de catre Pol I si Pol III nu necesita ATP spre deosebire de initierea realizata de Pol II care depinde de hidroliza ATP;

            Bacteriofagul T7 si bacteriofagii inruditi exprima o ARN polimeraza monomera simpla. Aceste polimeraze recunosc o regiune promotoare de 23 pb care include situsul de start;

            Mitocondria contine molecule circulare de ADN transcrise de catre o ARN polimeraza codificata nuclear compusa din doua subunitati. O subunitate este omologa cu  ARN polimeraza simpla din bacteriofagul T7; cealalta se aseamana cu factorii bacterieni sigma;

            Cloroplastele contin ADN care este transcris de catre o ARN polimeraza codificata de cloroplast omologa cu ARN polimerazele bacteriane, cu exceptia ca aceasta este lipsita de factorul sigma;

            Archeobacteriile utilizeaza o ARN polimeraza formata din mai multe subunitati care se aseamana cu ARN polimerazele eucariote nucleare. Initierea transcriptiei in celulele de archeobacterii necesita o proteina, omologa cu factorul eucariotic TBP,  care se leaga la un element promotor bogat in A/T situat imediat in amonte fata de situsul de start si o proteina omologa cu TFIIB. Aceste rezultate sustin ipoteza ca eucariotele si acheobacteriile actuale au evoluat dintr-un stramos comun. 








Politica de confidentialitate

DISTRIBUIE DOCUMENTUL

Comentarii


Vizualizari: 1618
Importanta: rank

Comenteaza documentul:

Te rugam sa te autentifici sau sa iti faci cont pentru a putea comenta

Creaza cont nou

Termeni si conditii de utilizare | Contact
© SCRIGROUP 2019 . All rights reserved

Distribuie URL

Adauga cod HTML in site